rt pre amplification master mix Search Results


99
Thermo Fisher sterile phosphate buffered solution
Data obtained from the chosen articles.
Sterile Phosphate Buffered Solution, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rt+pre+amplification+master+mix/pmc07886636-39-44-82?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
sterile phosphate buffered solution - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
ATCC mouse c2c12 myoblasts
Effect of miR-30-5p on differentiation of <t>C2C12</t> myoblasts. ( A ) Constructs and expression of miR-30-5p. RT-qPCR detection of mature miR-30-5p, using RNA prepared from C2C12 cells transfected with the expression constructs of miR-30-5p during the differentiation, confirming proper processing of miR-30-5p. The cells transfected with pcDNA3.1(+) as the control; ( B ) Western blot detection for MHC and MyoG proteins in the differentiated C2C12 cells respectively transfected miR-30a-5p, miR-30b-5p and miR-30e-5p constructs for six days in differentiation medium (DM). β-Tubulin was used as the loading control; ( C ) The C2C12 cells cultivated in DM (magnification 10×); ( D ) The expression levels of MHC and MyoG in C2C12 cells co-transfected with equivalent amount of miR-30a-5p, miR-30b-5p and miR-30e-5p were detected by RT-qPCR at 6 days after transfection in DM. control represents the C2C12 cells not transfected by miR-30-5p. Asterisks indicate significant differences. * p < 0.05; Error bars indicate SD ( n = 3). Days (d) indicate the time the cells were in the differentiation medium. The expression level was normalized to GAPDH.
Mouse C2c12 Myoblasts, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rt+pre+amplification+master+mix/pmc04783916-153-0-3?v=ATCC
Average 99 stars, based on 1 article reviews
mouse c2c12 myoblasts - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
Qiagen miscript mirna pcr system
Effect of miR-30-5p on differentiation of <t>C2C12</t> myoblasts. ( A ) Constructs and expression of miR-30-5p. RT-qPCR detection of mature miR-30-5p, using RNA prepared from C2C12 cells transfected with the expression constructs of miR-30-5p during the differentiation, confirming proper processing of miR-30-5p. The cells transfected with pcDNA3.1(+) as the control; ( B ) Western blot detection for MHC and MyoG proteins in the differentiated C2C12 cells respectively transfected miR-30a-5p, miR-30b-5p and miR-30e-5p constructs for six days in differentiation medium (DM). β-Tubulin was used as the loading control; ( C ) The C2C12 cells cultivated in DM (magnification 10×); ( D ) The expression levels of MHC and MyoG in C2C12 cells co-transfected with equivalent amount of miR-30a-5p, miR-30b-5p and miR-30e-5p were detected by RT-qPCR at 6 days after transfection in DM. control represents the C2C12 cells not transfected by miR-30-5p. Asterisks indicate significant differences. * p < 0.05; Error bars indicate SD ( n = 3). Days (d) indicate the time the cells were in the differentiation medium. The expression level was normalized to GAPDH.
Miscript Mirna Pcr System, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rt+pre+amplification+master+mix/pmc05766467-65-11-42?v=Qiagen
Average 99 stars, based on 1 article reviews
miscript mirna pcr system - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

96
New England Biolabs monoclonal antibody
Outcome of expression of the MAGI1 N-terminal peptides on cell proliferation signalling. MDA-MB-231 cells (10 5 ) were transfected to express the N-terminal of MAGI1 with and without the PDZ1 domain. Selected sets of cells were also pre-incubated with <t>SAM11</t> antibody (20 µg/ml) as shown in the figures. The cells were lysed and proteins separated by denaturing 12% (w/v) polyacrylamide electrophoresis, transferred onto nitrocellulose membranes and blocked with TBST. A The membranes were probed with a goat anti-human Akt1/2 (N-19) polyclonal antibody and a rabbit polyclonal anti-human Akt1 (phospho-S473). The membranes were then washed and probed with a donkey anti-goat, or goat anti-rabbit alkaline phosphatase-conjugated antibody, diluted 1:4000 (v/v). Bands were visualised using the Western Blue stabilised alkaline phosphatase-substrate, recorded using ImageJ program and ( B ) the ratios calculated. C Separate sets of the western blot membrane were probed using an anti-phosphoT202/185-phosphoY204/187-ERK1/2 antibody or alternatively, total ERK1/2 was detected using an anti-ERK1/2 antibody diluted 1:3000 (v/v) in TBST. The membranes were also probed using a rabbit anti-GAPDH polyclonal antibody (V-18) diluted 1:5000 (v/v) in TBST. The membranes were then incubated with a goat anti-rabbit alkaline or a donkey anti-goat phosphatase-conjugated antibody diluted 1:5000 (v/v) in TBST and visualised as above, recorded using ImageJ program and ( D ) the ratios calculated. MDA-MB-231 cells (10 5 ) were transfected to express the N-terminal of MAGI1 with and without the PDZ1 domain. Sets of cells were pre-incubated with a <t>monoclonal</t> antibody (SAM11; 20 µg/ml) to block PAR2 activation, or a mouse monoclonal antibody capable of inhibiting the protease activity of TF-fVIIa complex (HTF1; 20 µg/ml). E Total RNA was isolated from one set of the cells, and samples (100 ng) were amplified using the primers 5’- CCG TCC ATG CGG AAG ATC -3’ (forward) and 5’- ATG GCC AGC GGG AAG AC -3’ (reverse). The reaction was carried out at an annealing temperature of 60 °C using the GoTaq® 1-Step RT-qPCR for 40 cycles. Following amplification, the relative amounts of target mRNA were determined using the 2 −ΔΔCT method. F Cell numbers were determined in the second sets of cells using the crystal violet method
Monoclonal Antibody, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rt+pre+amplification+master+mix/pmc10792917-104-26-63?v=New+England+Biolabs
Average 96 stars, based on 1 article reviews
monoclonal antibody - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

94
Thermo Fisher advanced mirna mmu mir 200c 3p 478351 mir
Outcome of expression of the MAGI1 N-terminal peptides on cell proliferation signalling. MDA-MB-231 cells (10 5 ) were transfected to express the N-terminal of MAGI1 with and without the PDZ1 domain. Selected sets of cells were also pre-incubated with <t>SAM11</t> antibody (20 µg/ml) as shown in the figures. The cells were lysed and proteins separated by denaturing 12% (w/v) polyacrylamide electrophoresis, transferred onto nitrocellulose membranes and blocked with TBST. A The membranes were probed with a goat anti-human Akt1/2 (N-19) polyclonal antibody and a rabbit polyclonal anti-human Akt1 (phospho-S473). The membranes were then washed and probed with a donkey anti-goat, or goat anti-rabbit alkaline phosphatase-conjugated antibody, diluted 1:4000 (v/v). Bands were visualised using the Western Blue stabilised alkaline phosphatase-substrate, recorded using ImageJ program and ( B ) the ratios calculated. C Separate sets of the western blot membrane were probed using an anti-phosphoT202/185-phosphoY204/187-ERK1/2 antibody or alternatively, total ERK1/2 was detected using an anti-ERK1/2 antibody diluted 1:3000 (v/v) in TBST. The membranes were also probed using a rabbit anti-GAPDH polyclonal antibody (V-18) diluted 1:5000 (v/v) in TBST. The membranes were then incubated with a goat anti-rabbit alkaline or a donkey anti-goat phosphatase-conjugated antibody diluted 1:5000 (v/v) in TBST and visualised as above, recorded using ImageJ program and ( D ) the ratios calculated. MDA-MB-231 cells (10 5 ) were transfected to express the N-terminal of MAGI1 with and without the PDZ1 domain. Sets of cells were pre-incubated with a <t>monoclonal</t> antibody (SAM11; 20 µg/ml) to block PAR2 activation, or a mouse monoclonal antibody capable of inhibiting the protease activity of TF-fVIIa complex (HTF1; 20 µg/ml). E Total RNA was isolated from one set of the cells, and samples (100 ng) were amplified using the primers 5’- CCG TCC ATG CGG AAG ATC -3’ (forward) and 5’- ATG GCC AGC GGG AAG AC -3’ (reverse). The reaction was carried out at an annealing temperature of 60 °C using the GoTaq® 1-Step RT-qPCR for 40 cycles. Following amplification, the relative amounts of target mRNA were determined using the 2 −ΔΔCT method. F Cell numbers were determined in the second sets of cells using the crystal violet method
Advanced Mirna Mmu Mir 200c 3p 478351 Mir, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rt+pre+amplification+master+mix/pmc05669890__oncotarget___08___82294___s001-20-39-16?v=Thermo+Fisher
Average 94 stars, based on 1 article reviews
advanced mirna mmu mir 200c 3p 478351 mir - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

94
R&D Systems anti mouse progranulin antibody
(A) Schematic of the Tie2-Grn targeting vector. (B) PCR-based quantification of the Tie2-Grn copy number in the three Tie2-Grn lines. N = 3 for each line, error bars denote +/− S.E. One-Way ANOVA indicated significant difference between groups (3 lines) at the 0.001 level. (C) qRT-PCR of Tie2-Grn mRNA in adult (3 months old) mouse tissues expressed as log 10 (Relative Expression Ratio) calculated as the expression in the Tie2-Grn positive mice divided by baseline non-specific amplification and normalized to β-actin from Tie2-Grn negative tissues. Error bars denote +/− S.E. N = 8 (GrnLo), N = 3 (GrnMid), N = 1 (GrnHi). (D) PCR products for the Tie2-Grn mRNA analyzed by agarose gel, demonstrating the specificity of the amplification reaction for the Tie2-Grn mRNA and lack of product in the Tie2-Grn negative tissues. (E) <t>Progranulin</t> protein serum levels in the GrnMid and GrnHi line. Error bars denote +/− S.E. N = 4 (GrnMid) and N = 5 (GrnHi). Independent samples T-test revealed significant difference, p = 0.008 (two-tailed). (F) PECAM, a marker for endothelial cells, and progranulin immunostaining overlaps in the adult cerebellum. Immunostaining for progranulin in the adult cerebellum from a Tie2-Grn negative mouse (G) and a positive littermate (H). Capillaries are indicated by arrowheads. Note also that some neurons, such as Purkinje cells (PC) stain for progranulin. The scale bar indicates 20 µm in all sections. Asterisks indicate statistical significance in 1B and E; significance of <0.001 is ***, <0.01 is ** and <0.05 is *.
Anti Mouse Progranulin Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rt+pre+amplification+master+mix/pmc03669103-258-1-9?v=R%26D+Systems
Average 94 stars, based on 1 article reviews
anti mouse progranulin antibody - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

86
Thermo Fisher gene exp egfr hs01076076 m1
Expression of EGFRvIII as a fraction of total <t>EGFR</t> is quantified by Nanostring assay and qRT-PCR in 189 GBMs. a Expression of EGFRvIII (exon 1–8 junctional probe) is shown as a function of EGFR kinase domain ( KD ), determined by normalized Nanostring ( NS ) counts. Expression levels are classified as high [ red mutation in >10 % transcribed allelic fraction ( TAF )], intermediate ( orange 1–10 % TAF), marginal ( black <1 % TAF) or negative ( open circles ). These color assignments are carried through panels b – d . b Correlation of EGFRvIII expression between NS and qRT-PCR. Normalized expression levels are plotted for EGFRvIII and KD from the Taqman assay (see “ ”). Samples are colored according to NS expression classification from Fig. 1a. c Cross-platform correlation of EGFRvIII epression, NS vs. qRT-PCR. d Cross-platform correlation of EGFRvIII as a fraction of total EGFR, NS vs. qRT-PCR. e Experimental design of dilution experiment to establish linearity of the Nanostring assay. A sample with high relative expression of EGFRvIII was diluted with a sample negative for EGFRvIII expression, maintaining a constant 250 ng of total RNA in each reaction. f Counts of EGFRvIII and EGFR KD as a function of diluted fraction of EGFRvIII-containing sample
Gene Exp Egfr Hs01076076 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rt+pre+amplification+master+mix/pmc03984672-38-64-60?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
gene exp egfr hs01076076 m1 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

96
Thermo Fisher cellsdirect onestep q rt kit
Expression of EGFRvIII as a fraction of total <t>EGFR</t> is quantified by Nanostring assay and qRT-PCR in 189 GBMs. a Expression of EGFRvIII (exon 1–8 junctional probe) is shown as a function of EGFR kinase domain ( KD ), determined by normalized Nanostring ( NS ) counts. Expression levels are classified as high [ red mutation in >10 % transcribed allelic fraction ( TAF )], intermediate ( orange 1–10 % TAF), marginal ( black <1 % TAF) or negative ( open circles ). These color assignments are carried through panels b – d . b Correlation of EGFRvIII expression between NS and qRT-PCR. Normalized expression levels are plotted for EGFRvIII and KD from the Taqman assay (see “ ”). Samples are colored according to NS expression classification from Fig. 1a. c Cross-platform correlation of EGFRvIII epression, NS vs. qRT-PCR. d Cross-platform correlation of EGFRvIII as a fraction of total EGFR, NS vs. qRT-PCR. e Experimental design of dilution experiment to establish linearity of the Nanostring assay. A sample with high relative expression of EGFRvIII was diluted with a sample negative for EGFRvIII expression, maintaining a constant 250 ng of total RNA in each reaction. f Counts of EGFRvIII and EGFR KD as a function of diluted fraction of EGFRvIII-containing sample
Cellsdirect Onestep Q Rt Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rt+pre+amplification+master+mix/bio_rxiv__240523-197-10-14?v=Thermo+Fisher
Average 96 stars, based on 1 article reviews
cellsdirect onestep q rt kit - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

89
Thermo Fisher gene exp mbd3l2 hs00544743 m1
Expression of EGFRvIII as a fraction of total <t>EGFR</t> is quantified by Nanostring assay and qRT-PCR in 189 GBMs. a Expression of EGFRvIII (exon 1–8 junctional probe) is shown as a function of EGFR kinase domain ( KD ), determined by normalized Nanostring ( NS ) counts. Expression levels are classified as high [ red mutation in >10 % transcribed allelic fraction ( TAF )], intermediate ( orange 1–10 % TAF), marginal ( black <1 % TAF) or negative ( open circles ). These color assignments are carried through panels b – d . b Correlation of EGFRvIII expression between NS and qRT-PCR. Normalized expression levels are plotted for EGFRvIII and KD from the Taqman assay (see “ ”). Samples are colored according to NS expression classification from Fig. 1a. c Cross-platform correlation of EGFRvIII epression, NS vs. qRT-PCR. d Cross-platform correlation of EGFRvIII as a fraction of total EGFR, NS vs. qRT-PCR. e Experimental design of dilution experiment to establish linearity of the Nanostring assay. A sample with high relative expression of EGFRvIII was diluted with a sample negative for EGFRvIII expression, maintaining a constant 250 ng of total RNA in each reaction. f Counts of EGFRvIII and EGFR KD as a function of diluted fraction of EGFRvIII-containing sample
Gene Exp Mbd3l2 Hs00544743 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rt+pre+amplification+master+mix/pmc04581613-441-52-55?v=Thermo+Fisher
Average 89 stars, based on 1 article reviews
gene exp mbd3l2 hs00544743 m1 - by Bioz Stars, 2026-08
89/100 stars
  Buy from Supplier

86
Thermo Fisher gene exp bace1 hs01121195 m1
List of monoclonal and polyclonal antibodies used in the study
Gene Exp Bace1 Hs01121195 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rt+pre+amplification+master+mix/pmc05389045-129-23-41?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
gene exp bace1 hs01121195 m1 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

91
Thermo Fisher advanced mirna mne mir 21 477975 mir
List of monoclonal and polyclonal antibodies used in the study
Advanced Mirna Mne Mir 21 477975 Mir, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rt+pre+amplification+master+mix/pmc05669890__oncotarget___08___82294___s001-20-30-16?v=Thermo+Fisher
Average 91 stars, based on 1 article reviews
advanced mirna mne mir 21 477975 mir - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier

92
R&D Systems agoatanti human hb egf antibody
Expression of <t>proHB-EGF</t> under the control of the villin promoter. (A) Villin vector. The vector consists of the 12.4 kb villin promoter sequence and the SV40 polyA signals and intron. The Mlu I and SacII sites where the <t>HB-EGF</t> sequence has been inserted are shown. The two PmeI cut sites for release of the entire construct are also labeled. The asterisk represents the initiation site for transcription of the villin sequences. (B) Villin-proHB-EGF construct. Human precursor HB-EGF cDNA (625 bp) was inserted into the Mlu I and SacII sites at the 3′ end of the villin promoter. (C) PCR of potential HB-EGF TG founder mice. Eight potential founder mice derived from Vill-HB-EGF-injected oocytes were screened for genomic integration of the HB-EGF transgene by PCR of tail DNA using villin promoter and HB-EGF sequence specific primers (top panel). Mouse specific β-actin primers were used as an internal control for amplification (bottom panel). Two HB-EGF TG mice were identified (lanes 2 and 4). c, control DNA (Villin-proHB-EGF). (D) Southern blot analysis of potential HB-EGF TG founder mice. DNA was isolated from the tails of the same eight potential founder mice and subjected to Southern blot analysis using HB-EGF specific probes. The positive bands in lanes 2 and 4 correlated with the PCR results, confirming the identification of two HB-EGF TG mice. C, FVB control DNA.
Agoatanti Human Hb Egf Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rt+pre+amplification+master+mix/pmc03821006-194-0-4?v=R%26D+Systems
Average 92 stars, based on 1 article reviews
agoatanti human hb egf antibody - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier

Image Search Results


Data obtained from the chosen articles.

Journal: The Science of the Total Environment

Article Title: Sampling methods and assays applied in SARS-CoV-2 exposure assessment

doi: 10.1016/j.scitotenv.2021.145903

Figure Lengend Snippet: Data obtained from the chosen articles.

Article Snippet: , 34. SARS-CoV-2 RNA contamination on surfaces of a COVID-19 ward in a hospital of Northern Italy: what risk of transmission? , Italy , No , Surface samples from ward in University Hospital of Ferrara , Sampling performed with sterile rayon swabs pre-moistened in sterile phosphate-buffered solution , Viral RNA extraction with Patho Gene-spin Extraction kit (Generon) RT-qPCR targeted the RNA-dependent RNA polymerase ( RdRp ) gene (Generon), and the orf1ab , spike ( S ), and nucleocapsid ( N ) genes (ThermoFisher) , • SARS-CoV-2 was only detected in 3 samples of two floors and one-bathroom sink. • Reported to persist for a longer duration on surfaces under controlled laboratory conditions. , ( ) .

Techniques: Sampling, Lysis, RNA Extraction, Environmental Monitoring, Virus, Multiplex Assay, Northern Blot, Marker, RNA Detection, Isolation, Membrane, Control, Environmental Sampling, Amplification, Transmission Assay, Aerosol, Diagnostic Assay, Infection, Sterility, Real-time Polymerase Chain Reaction, Nested PCR, Reverse Transcription, Extraction, Purification, Digital PCR, Preserving, Quantitative RT-PCR, cDNA Synthesis, Magnetic Beads, Incubation, Modification, One Step RT-PCR, Cell Culture, Sequencing

Effect of miR-30-5p on differentiation of C2C12 myoblasts. ( A ) Constructs and expression of miR-30-5p. RT-qPCR detection of mature miR-30-5p, using RNA prepared from C2C12 cells transfected with the expression constructs of miR-30-5p during the differentiation, confirming proper processing of miR-30-5p. The cells transfected with pcDNA3.1(+) as the control; ( B ) Western blot detection for MHC and MyoG proteins in the differentiated C2C12 cells respectively transfected miR-30a-5p, miR-30b-5p and miR-30e-5p constructs for six days in differentiation medium (DM). β-Tubulin was used as the loading control; ( C ) The C2C12 cells cultivated in DM (magnification 10×); ( D ) The expression levels of MHC and MyoG in C2C12 cells co-transfected with equivalent amount of miR-30a-5p, miR-30b-5p and miR-30e-5p were detected by RT-qPCR at 6 days after transfection in DM. control represents the C2C12 cells not transfected by miR-30-5p. Asterisks indicate significant differences. * p < 0.05; Error bars indicate SD ( n = 3). Days (d) indicate the time the cells were in the differentiation medium. The expression level was normalized to GAPDH.

Journal: International Journal of Molecular Sciences

Article Title: miR-30-5p Regulates Muscle Differentiation and Alternative Splicing of Muscle-Related Genes by Targeting MBNL

doi: 10.3390/ijms17020182

Figure Lengend Snippet: Effect of miR-30-5p on differentiation of C2C12 myoblasts. ( A ) Constructs and expression of miR-30-5p. RT-qPCR detection of mature miR-30-5p, using RNA prepared from C2C12 cells transfected with the expression constructs of miR-30-5p during the differentiation, confirming proper processing of miR-30-5p. The cells transfected with pcDNA3.1(+) as the control; ( B ) Western blot detection for MHC and MyoG proteins in the differentiated C2C12 cells respectively transfected miR-30a-5p, miR-30b-5p and miR-30e-5p constructs for six days in differentiation medium (DM). β-Tubulin was used as the loading control; ( C ) The C2C12 cells cultivated in DM (magnification 10×); ( D ) The expression levels of MHC and MyoG in C2C12 cells co-transfected with equivalent amount of miR-30a-5p, miR-30b-5p and miR-30e-5p were detected by RT-qPCR at 6 days after transfection in DM. control represents the C2C12 cells not transfected by miR-30-5p. Asterisks indicate significant differences. * p < 0.05; Error bars indicate SD ( n = 3). Days (d) indicate the time the cells were in the differentiation medium. The expression level was normalized to GAPDH.

Article Snippet: Mouse C2C12 myoblasts (ATCC; USA) were maintained in high-glucose DMEM supplemented with 10% fetal bovine serum (GM) and cultured at 37 °C with 5% CO 2 .

Techniques: Construct, Expressing, Quantitative RT-PCR, Transfection, Control, Western Blot

miR-30-5p directly targets MBNL. ( A ) The expression level of MBNL1 and miR-30-5p (miR-30a-5p, miR-30b-5p and miR-30e-5p) in the C2C12 cells co-transfected with miR-30-5p at DM 0, 1, 2, 3, 4, 5 and 6 days; ( B ) Constructs and expression of miR-30-5p. RT-qPCR detection of mature miR-30-5p, using RNA prepared from HEK293T cells transfected with the expression constructs of miR-30-5p, confirming proper processing of miR-30-5p. The cells transfected with pcDNA3.1(+) as the control; ( C ) Western blot analysis of MBNL1 protein levels regulated by miR-30-5p in the HEK293T cells respectively transfected with miR-30a-5p, miR-30b-5p and miR-30e-5p. Control was the cells without any treatment. β-Tubulin was used as the loading control; ( D ) Sequence alignment of potential binding site of miR-30-5p in the 3′ UTR of MBNL1, MBNL2 and MBNL3. Cattle wild type (MBNL1-WT) is upper and mutated type (MBNL2-Mut) is lower. The potential binding sites and the seed sequences of miR-30-5p were showed with potential binding sites underlined. The red font stands for the mutated bases in the potential binding site; ( E ) Luciferase assays for the direct evidence of miR-30-5p targeing MBNL1. miR-30a-5p, miR-30b-5p and miR-30e-5p were respectively transfected into HEK293T cells with the luciferase reporter constructs harbouring potential binding sites of miR-30-5p (MBNL1-WT) or the luciferase reporter constructs harbouring mutant potential binding sites of miR-30-5p (MBNL1-Mut); ( F – H ) miR-30-5p directly targets MBNL2; ( I – K ) miR-30-5p directly targets MBNL3. As a control, the empty luciferase reporter vector (control) was co-transfected into HEK293T cells with miR-30-5p. Asterisks indicate significant differences. * p < 0.05; ** p < 0.01. Error bars indicate SD ( n = 3).

Journal: International Journal of Molecular Sciences

Article Title: miR-30-5p Regulates Muscle Differentiation and Alternative Splicing of Muscle-Related Genes by Targeting MBNL

doi: 10.3390/ijms17020182

Figure Lengend Snippet: miR-30-5p directly targets MBNL. ( A ) The expression level of MBNL1 and miR-30-5p (miR-30a-5p, miR-30b-5p and miR-30e-5p) in the C2C12 cells co-transfected with miR-30-5p at DM 0, 1, 2, 3, 4, 5 and 6 days; ( B ) Constructs and expression of miR-30-5p. RT-qPCR detection of mature miR-30-5p, using RNA prepared from HEK293T cells transfected with the expression constructs of miR-30-5p, confirming proper processing of miR-30-5p. The cells transfected with pcDNA3.1(+) as the control; ( C ) Western blot analysis of MBNL1 protein levels regulated by miR-30-5p in the HEK293T cells respectively transfected with miR-30a-5p, miR-30b-5p and miR-30e-5p. Control was the cells without any treatment. β-Tubulin was used as the loading control; ( D ) Sequence alignment of potential binding site of miR-30-5p in the 3′ UTR of MBNL1, MBNL2 and MBNL3. Cattle wild type (MBNL1-WT) is upper and mutated type (MBNL2-Mut) is lower. The potential binding sites and the seed sequences of miR-30-5p were showed with potential binding sites underlined. The red font stands for the mutated bases in the potential binding site; ( E ) Luciferase assays for the direct evidence of miR-30-5p targeing MBNL1. miR-30a-5p, miR-30b-5p and miR-30e-5p were respectively transfected into HEK293T cells with the luciferase reporter constructs harbouring potential binding sites of miR-30-5p (MBNL1-WT) or the luciferase reporter constructs harbouring mutant potential binding sites of miR-30-5p (MBNL1-Mut); ( F – H ) miR-30-5p directly targets MBNL2; ( I – K ) miR-30-5p directly targets MBNL3. As a control, the empty luciferase reporter vector (control) was co-transfected into HEK293T cells with miR-30-5p. Asterisks indicate significant differences. * p < 0.05; ** p < 0.01. Error bars indicate SD ( n = 3).

Article Snippet: Mouse C2C12 myoblasts (ATCC; USA) were maintained in high-glucose DMEM supplemented with 10% fetal bovine serum (GM) and cultured at 37 °C with 5% CO 2 .

Techniques: Expressing, Transfection, Construct, Quantitative RT-PCR, Control, Western Blot, Sequencing, Binding Assay, Luciferase, Mutagenesis, Plasmid Preparation

MBNL1 represses muscle differentiation ( A ) The mRNA expression level of MBNL1 in C2C12 cells transfected with siRNA (siRNA-1 and siRNA-2); ( B ) The mRNA expression level of MyoG and MHC in C2C12 cells in differentiation medium for 36 h after transfection; The expression level was normalized to GAPDH; ( C ) Western blot detection for MHC and MyoG proteins after transfection with siRNA-1 into C2C12 cells in differentiation medium for two days. β-Tubulin was used as the loading control. The cells transfected with NC were control. Asterisks indicate significant differences. * p < 0.05; Error bars indicate SD ( n = 3).

Journal: International Journal of Molecular Sciences

Article Title: miR-30-5p Regulates Muscle Differentiation and Alternative Splicing of Muscle-Related Genes by Targeting MBNL

doi: 10.3390/ijms17020182

Figure Lengend Snippet: MBNL1 represses muscle differentiation ( A ) The mRNA expression level of MBNL1 in C2C12 cells transfected with siRNA (siRNA-1 and siRNA-2); ( B ) The mRNA expression level of MyoG and MHC in C2C12 cells in differentiation medium for 36 h after transfection; The expression level was normalized to GAPDH; ( C ) Western blot detection for MHC and MyoG proteins after transfection with siRNA-1 into C2C12 cells in differentiation medium for two days. β-Tubulin was used as the loading control. The cells transfected with NC were control. Asterisks indicate significant differences. * p < 0.05; Error bars indicate SD ( n = 3).

Article Snippet: Mouse C2C12 myoblasts (ATCC; USA) were maintained in high-glucose DMEM supplemented with 10% fetal bovine serum (GM) and cultured at 37 °C with 5% CO 2 .

Techniques: Expressing, Transfection, Western Blot, Control

Effect of miR-30-5p on alternative splicing of Trim55 and INSR ( A , B ) The primers for the alternative splicing of Trim55 and INSR; ( C ) Total RNA during the six days of C2C12 cells’ differentiation was extracted, and cDNA was amplified. The cDNA was used to produce the Trim55(exon9+) and INSR(exon11+), which were detected by gel electrophoresis; ( D ) Relative expression levels of Trim55(exon9+) at six days in differentiation medium; ( E ) Relative expression levels of and INSR(exon11+) at six days in differentiation medium. DM six day control represents the C2C12 cells not transfected by miR-30-5p. Asterisks indicate significant differences. * p < 0.05; the expression level was normalized to GAPDH. Error bars indicate SD ( n = 3).

Journal: International Journal of Molecular Sciences

Article Title: miR-30-5p Regulates Muscle Differentiation and Alternative Splicing of Muscle-Related Genes by Targeting MBNL

doi: 10.3390/ijms17020182

Figure Lengend Snippet: Effect of miR-30-5p on alternative splicing of Trim55 and INSR ( A , B ) The primers for the alternative splicing of Trim55 and INSR; ( C ) Total RNA during the six days of C2C12 cells’ differentiation was extracted, and cDNA was amplified. The cDNA was used to produce the Trim55(exon9+) and INSR(exon11+), which were detected by gel electrophoresis; ( D ) Relative expression levels of Trim55(exon9+) at six days in differentiation medium; ( E ) Relative expression levels of and INSR(exon11+) at six days in differentiation medium. DM six day control represents the C2C12 cells not transfected by miR-30-5p. Asterisks indicate significant differences. * p < 0.05; the expression level was normalized to GAPDH. Error bars indicate SD ( n = 3).

Article Snippet: Mouse C2C12 myoblasts (ATCC; USA) were maintained in high-glucose DMEM supplemented with 10% fetal bovine serum (GM) and cultured at 37 °C with 5% CO 2 .

Techniques: Alternative Splicing, Amplification, Nucleic Acid Electrophoresis, Expressing, Control, Transfection

Outcome of expression of the MAGI1 N-terminal peptides on cell proliferation signalling. MDA-MB-231 cells (10 5 ) were transfected to express the N-terminal of MAGI1 with and without the PDZ1 domain. Selected sets of cells were also pre-incubated with SAM11 antibody (20 µg/ml) as shown in the figures. The cells were lysed and proteins separated by denaturing 12% (w/v) polyacrylamide electrophoresis, transferred onto nitrocellulose membranes and blocked with TBST. A The membranes were probed with a goat anti-human Akt1/2 (N-19) polyclonal antibody and a rabbit polyclonal anti-human Akt1 (phospho-S473). The membranes were then washed and probed with a donkey anti-goat, or goat anti-rabbit alkaline phosphatase-conjugated antibody, diluted 1:4000 (v/v). Bands were visualised using the Western Blue stabilised alkaline phosphatase-substrate, recorded using ImageJ program and ( B ) the ratios calculated. C Separate sets of the western blot membrane were probed using an anti-phosphoT202/185-phosphoY204/187-ERK1/2 antibody or alternatively, total ERK1/2 was detected using an anti-ERK1/2 antibody diluted 1:3000 (v/v) in TBST. The membranes were also probed using a rabbit anti-GAPDH polyclonal antibody (V-18) diluted 1:5000 (v/v) in TBST. The membranes were then incubated with a goat anti-rabbit alkaline or a donkey anti-goat phosphatase-conjugated antibody diluted 1:5000 (v/v) in TBST and visualised as above, recorded using ImageJ program and ( D ) the ratios calculated. MDA-MB-231 cells (10 5 ) were transfected to express the N-terminal of MAGI1 with and without the PDZ1 domain. Sets of cells were pre-incubated with a monoclonal antibody (SAM11; 20 µg/ml) to block PAR2 activation, or a mouse monoclonal antibody capable of inhibiting the protease activity of TF-fVIIa complex (HTF1; 20 µg/ml). E Total RNA was isolated from one set of the cells, and samples (100 ng) were amplified using the primers 5’- CCG TCC ATG CGG AAG ATC -3’ (forward) and 5’- ATG GCC AGC GGG AAG AC -3’ (reverse). The reaction was carried out at an annealing temperature of 60 °C using the GoTaq® 1-Step RT-qPCR for 40 cycles. Following amplification, the relative amounts of target mRNA were determined using the 2 −ΔΔCT method. F Cell numbers were determined in the second sets of cells using the crystal violet method

Journal: Thrombosis Journal

Article Title: Regulation of tissue factor activity by interaction with the first PDZ domain of MAGI1

doi: 10.1186/s12959-023-00580-6

Figure Lengend Snippet: Outcome of expression of the MAGI1 N-terminal peptides on cell proliferation signalling. MDA-MB-231 cells (10 5 ) were transfected to express the N-terminal of MAGI1 with and without the PDZ1 domain. Selected sets of cells were also pre-incubated with SAM11 antibody (20 µg/ml) as shown in the figures. The cells were lysed and proteins separated by denaturing 12% (w/v) polyacrylamide electrophoresis, transferred onto nitrocellulose membranes and blocked with TBST. A The membranes were probed with a goat anti-human Akt1/2 (N-19) polyclonal antibody and a rabbit polyclonal anti-human Akt1 (phospho-S473). The membranes were then washed and probed with a donkey anti-goat, or goat anti-rabbit alkaline phosphatase-conjugated antibody, diluted 1:4000 (v/v). Bands were visualised using the Western Blue stabilised alkaline phosphatase-substrate, recorded using ImageJ program and ( B ) the ratios calculated. C Separate sets of the western blot membrane were probed using an anti-phosphoT202/185-phosphoY204/187-ERK1/2 antibody or alternatively, total ERK1/2 was detected using an anti-ERK1/2 antibody diluted 1:3000 (v/v) in TBST. The membranes were also probed using a rabbit anti-GAPDH polyclonal antibody (V-18) diluted 1:5000 (v/v) in TBST. The membranes were then incubated with a goat anti-rabbit alkaline or a donkey anti-goat phosphatase-conjugated antibody diluted 1:5000 (v/v) in TBST and visualised as above, recorded using ImageJ program and ( D ) the ratios calculated. MDA-MB-231 cells (10 5 ) were transfected to express the N-terminal of MAGI1 with and without the PDZ1 domain. Sets of cells were pre-incubated with a monoclonal antibody (SAM11; 20 µg/ml) to block PAR2 activation, or a mouse monoclonal antibody capable of inhibiting the protease activity of TF-fVIIa complex (HTF1; 20 µg/ml). E Total RNA was isolated from one set of the cells, and samples (100 ng) were amplified using the primers 5’- CCG TCC ATG CGG AAG ATC -3’ (forward) and 5’- ATG GCC AGC GGG AAG AC -3’ (reverse). The reaction was carried out at an annealing temperature of 60 °C using the GoTaq® 1-Step RT-qPCR for 40 cycles. Following amplification, the relative amounts of target mRNA were determined using the 2 −ΔΔCT method. F Cell numbers were determined in the second sets of cells using the crystal violet method

Article Snippet: To further demonstrate the influence and the effectiveness of inclusion of PDZ1 within the N-terminal of MAGI1, cells were transfected as above and pre-incubated with a monoclonal antibody (SAM11; 20 µg/ml) capable of blocking PAR2 activation, or a mouse monoclonal antibody to inhibit the protease activity of TF-fVIIa complex (HTF1; 20 µg/ml; eBioscience/Thermo Scientific, Warrington, UK) [ ] or a mouse IgG isotypes (New England Biolabs).

Techniques: Expressing, Transfection, Incubation, Electrophoresis, Western Blot, Membrane, Blocking Assay, Activation Assay, Activity Assay, Isolation, Amplification, Quantitative RT-PCR

(A) Schematic of the Tie2-Grn targeting vector. (B) PCR-based quantification of the Tie2-Grn copy number in the three Tie2-Grn lines. N = 3 for each line, error bars denote +/− S.E. One-Way ANOVA indicated significant difference between groups (3 lines) at the 0.001 level. (C) qRT-PCR of Tie2-Grn mRNA in adult (3 months old) mouse tissues expressed as log 10 (Relative Expression Ratio) calculated as the expression in the Tie2-Grn positive mice divided by baseline non-specific amplification and normalized to β-actin from Tie2-Grn negative tissues. Error bars denote +/− S.E. N = 8 (GrnLo), N = 3 (GrnMid), N = 1 (GrnHi). (D) PCR products for the Tie2-Grn mRNA analyzed by agarose gel, demonstrating the specificity of the amplification reaction for the Tie2-Grn mRNA and lack of product in the Tie2-Grn negative tissues. (E) Progranulin protein serum levels in the GrnMid and GrnHi line. Error bars denote +/− S.E. N = 4 (GrnMid) and N = 5 (GrnHi). Independent samples T-test revealed significant difference, p = 0.008 (two-tailed). (F) PECAM, a marker for endothelial cells, and progranulin immunostaining overlaps in the adult cerebellum. Immunostaining for progranulin in the adult cerebellum from a Tie2-Grn negative mouse (G) and a positive littermate (H). Capillaries are indicated by arrowheads. Note also that some neurons, such as Purkinje cells (PC) stain for progranulin. The scale bar indicates 20 µm in all sections. Asterisks indicate statistical significance in 1B and E; significance of <0.001 is ***, <0.01 is ** and <0.05 is *.

Journal: PLoS ONE

Article Title: Expression of the Growth Factor Progranulin in Endothelial Cells Influences Growth and Development of Blood Vessels: A Novel Mouse Model

doi: 10.1371/journal.pone.0064989

Figure Lengend Snippet: (A) Schematic of the Tie2-Grn targeting vector. (B) PCR-based quantification of the Tie2-Grn copy number in the three Tie2-Grn lines. N = 3 for each line, error bars denote +/− S.E. One-Way ANOVA indicated significant difference between groups (3 lines) at the 0.001 level. (C) qRT-PCR of Tie2-Grn mRNA in adult (3 months old) mouse tissues expressed as log 10 (Relative Expression Ratio) calculated as the expression in the Tie2-Grn positive mice divided by baseline non-specific amplification and normalized to β-actin from Tie2-Grn negative tissues. Error bars denote +/− S.E. N = 8 (GrnLo), N = 3 (GrnMid), N = 1 (GrnHi). (D) PCR products for the Tie2-Grn mRNA analyzed by agarose gel, demonstrating the specificity of the amplification reaction for the Tie2-Grn mRNA and lack of product in the Tie2-Grn negative tissues. (E) Progranulin protein serum levels in the GrnMid and GrnHi line. Error bars denote +/− S.E. N = 4 (GrnMid) and N = 5 (GrnHi). Independent samples T-test revealed significant difference, p = 0.008 (two-tailed). (F) PECAM, a marker for endothelial cells, and progranulin immunostaining overlaps in the adult cerebellum. Immunostaining for progranulin in the adult cerebellum from a Tie2-Grn negative mouse (G) and a positive littermate (H). Capillaries are indicated by arrowheads. Note also that some neurons, such as Purkinje cells (PC) stain for progranulin. The scale bar indicates 20 µm in all sections. Asterisks indicate statistical significance in 1B and E; significance of <0.001 is ***, <0.01 is ** and <0.05 is *.

Article Snippet: The anti-mouse progranulin antibody (dilution 1∶70) was purchased from R&D systems, the anti-laminin antibody (dilution 1∶50) was purchased from Abcam, the anti-smooth muscle α-actin antibody (dilution 1∶100) and the anti-desmin (dilution 1∶100) were purchased from Dako; the anti-PECAM1 antibody (dilution 1∶25) was purchased from Santa Cruz and the VEGFR2 antibody (dilution 1∶600) was purchased from Cell Signaling.

Techniques: Plasmid Preparation, Quantitative RT-PCR, Expressing, Amplification, Agarose Gel Electrophoresis, Two Tailed Test, Marker, Immunostaining, Staining

(A–D) Appearance of embryos from E15.5 to E16.5 showed subcutaneous hemorrhage, often behind the head, (indicated by arrowheads, P is placenta) (A and B) or pale appearance (C and D) (indicated by arrowhead in C). Litters were genotyped either ex utero (D) or post-natally (E). Externally visible abnormalities were found only in Tie2-Grn positive mice. The phenotype is variable, as some Tie2-Grn positive mice were indistinguishable from the negative littermates. The genotype is indicated in the figure by (+) or (−). (F) The distribution of externally visible abnormalities in E15.5–17.5 fetuses, N = 29 from the GrnHi line and, (G) from P0–P1 live neonates, N = 59 from the GrnHi line. The neonates found dead were not included. (H) Levels of progranulin protein were higher in the amniotic fluid of the Tie2-Grn positive fetuses than negative fetuses (E16.5). Independent samples T-test showed significant difference between the transgenic and negative population, p = 0.007 (two-tailed). Errors bars denote +/− S.E. N = 6 from the GrnHi line only. Asterisks indicate statistical significance in 3H; significance of <0.01 is indicated by **.

Journal: PLoS ONE

Article Title: Expression of the Growth Factor Progranulin in Endothelial Cells Influences Growth and Development of Blood Vessels: A Novel Mouse Model

doi: 10.1371/journal.pone.0064989

Figure Lengend Snippet: (A–D) Appearance of embryos from E15.5 to E16.5 showed subcutaneous hemorrhage, often behind the head, (indicated by arrowheads, P is placenta) (A and B) or pale appearance (C and D) (indicated by arrowhead in C). Litters were genotyped either ex utero (D) or post-natally (E). Externally visible abnormalities were found only in Tie2-Grn positive mice. The phenotype is variable, as some Tie2-Grn positive mice were indistinguishable from the negative littermates. The genotype is indicated in the figure by (+) or (−). (F) The distribution of externally visible abnormalities in E15.5–17.5 fetuses, N = 29 from the GrnHi line and, (G) from P0–P1 live neonates, N = 59 from the GrnHi line. The neonates found dead were not included. (H) Levels of progranulin protein were higher in the amniotic fluid of the Tie2-Grn positive fetuses than negative fetuses (E16.5). Independent samples T-test showed significant difference between the transgenic and negative population, p = 0.007 (two-tailed). Errors bars denote +/− S.E. N = 6 from the GrnHi line only. Asterisks indicate statistical significance in 3H; significance of <0.01 is indicated by **.

Article Snippet: The anti-mouse progranulin antibody (dilution 1∶70) was purchased from R&D systems, the anti-laminin antibody (dilution 1∶50) was purchased from Abcam, the anti-smooth muscle α-actin antibody (dilution 1∶100) and the anti-desmin (dilution 1∶100) were purchased from Dako; the anti-PECAM1 antibody (dilution 1∶25) was purchased from Santa Cruz and the VEGFR2 antibody (dilution 1∶600) was purchased from Cell Signaling.

Techniques: Transgenic Assay, Two Tailed Test

(A) Sprouting capillaries (white arrow heads) in the brain and meninges of a Tie2-Grn positive embryo (PM, pia mater). (B) and (C) illustrate the appearance of the heart in a Tie2-Grn negative (B) and Tie2-Grn positive embryo (C), which are structurally similar. EC, endothelial cushion. (D–E) Trabeculation and the formation of the endothelial lining of the trabeculae are indistinguishable in a Tie2-Grn negative (D) and Tie2-Grn positive embryo (E) embryos. (Black arrow heads point to the endothelium covering the cardiac muscle of the trabeculae). A Tie2-Grn negative (F) and Tie2-Grn positive embryo (G) stained for progranulin demonstrate the increased production of progranulin in the endothelia (black arrow heads) of the Tie2-Grn positive embryo at E10.5. M, mandible; EC, endocardial cushion; T, trabeculae. Scale bars denote 20 µm. Images were obtained from the GrnHi line.

Journal: PLoS ONE

Article Title: Expression of the Growth Factor Progranulin in Endothelial Cells Influences Growth and Development of Blood Vessels: A Novel Mouse Model

doi: 10.1371/journal.pone.0064989

Figure Lengend Snippet: (A) Sprouting capillaries (white arrow heads) in the brain and meninges of a Tie2-Grn positive embryo (PM, pia mater). (B) and (C) illustrate the appearance of the heart in a Tie2-Grn negative (B) and Tie2-Grn positive embryo (C), which are structurally similar. EC, endothelial cushion. (D–E) Trabeculation and the formation of the endothelial lining of the trabeculae are indistinguishable in a Tie2-Grn negative (D) and Tie2-Grn positive embryo (E) embryos. (Black arrow heads point to the endothelium covering the cardiac muscle of the trabeculae). A Tie2-Grn negative (F) and Tie2-Grn positive embryo (G) stained for progranulin demonstrate the increased production of progranulin in the endothelia (black arrow heads) of the Tie2-Grn positive embryo at E10.5. M, mandible; EC, endocardial cushion; T, trabeculae. Scale bars denote 20 µm. Images were obtained from the GrnHi line.

Article Snippet: The anti-mouse progranulin antibody (dilution 1∶70) was purchased from R&D systems, the anti-laminin antibody (dilution 1∶50) was purchased from Abcam, the anti-smooth muscle α-actin antibody (dilution 1∶100) and the anti-desmin (dilution 1∶100) were purchased from Dako; the anti-PECAM1 antibody (dilution 1∶25) was purchased from Santa Cruz and the VEGFR2 antibody (dilution 1∶600) was purchased from Cell Signaling.

Techniques: Staining

H&E staining of the cerebral cortex of (A) a Tie2-Grn negative fetus with no hemorrhage sites and (B) a Tie2-Grn positive fetus. Small localized hemorrhages were observed in the cerebral cortex of the Tie2-Grn positive fetus (insert) but not the Tie2-Grn negative fetus. Capillaries (black arrow heads) were poorly stained for progranulin in the Tie2-Grn negative fetus (C), but displayed high levels of progranulin in the Tie2-Grn positive fetus (D). The basement membrane protein laminin clearly demarcated capillaries in the Tie2-Grn negative fetus (E, and insert). Some capillaries in the Tie2-Grn positive fetus showed strong laminin staining (tailed arrowhead) while other showed reduced laminin (flat arrowhead). Desmin, a marker for pericytes, was associated with capillaries in the Tie2-Grn negative fetus (F, and insert). Few capillaries in the Tie2-Grn positive were positive for desmin (arrowhead).

Journal: PLoS ONE

Article Title: Expression of the Growth Factor Progranulin in Endothelial Cells Influences Growth and Development of Blood Vessels: A Novel Mouse Model

doi: 10.1371/journal.pone.0064989

Figure Lengend Snippet: H&E staining of the cerebral cortex of (A) a Tie2-Grn negative fetus with no hemorrhage sites and (B) a Tie2-Grn positive fetus. Small localized hemorrhages were observed in the cerebral cortex of the Tie2-Grn positive fetus (insert) but not the Tie2-Grn negative fetus. Capillaries (black arrow heads) were poorly stained for progranulin in the Tie2-Grn negative fetus (C), but displayed high levels of progranulin in the Tie2-Grn positive fetus (D). The basement membrane protein laminin clearly demarcated capillaries in the Tie2-Grn negative fetus (E, and insert). Some capillaries in the Tie2-Grn positive fetus showed strong laminin staining (tailed arrowhead) while other showed reduced laminin (flat arrowhead). Desmin, a marker for pericytes, was associated with capillaries in the Tie2-Grn negative fetus (F, and insert). Few capillaries in the Tie2-Grn positive were positive for desmin (arrowhead).

Article Snippet: The anti-mouse progranulin antibody (dilution 1∶70) was purchased from R&D systems, the anti-laminin antibody (dilution 1∶50) was purchased from Abcam, the anti-smooth muscle α-actin antibody (dilution 1∶100) and the anti-desmin (dilution 1∶100) were purchased from Dako; the anti-PECAM1 antibody (dilution 1∶25) was purchased from Santa Cruz and the VEGFR2 antibody (dilution 1∶600) was purchased from Cell Signaling.

Techniques: Staining, Membrane, Marker

(A) VEGF-A protein levels in the amniotic fluid. Independent samples T-test revealed no significant difference in VEGF-A levels between the Tie2-Grn positive fetuses and the Tie2-Grn negative fetuses ( p = 0.423). Age of fetuses are E15.5–16.5. N = 8, GrnHi line. Error bars denote +/− S.E. VEGFR2 endothelial expression in (B) Tie2-Grn negative fetus and (C) Tie2-Grn positive fetus. Arrows show endothelial cells within the mesenteric vessels. (D) Serial sections of the Tie2-Grn vessel in (B) expressed progranulin. Scale bars denote 20 µm. Images were obtained from the GrnHi line.

Journal: PLoS ONE

Article Title: Expression of the Growth Factor Progranulin in Endothelial Cells Influences Growth and Development of Blood Vessels: A Novel Mouse Model

doi: 10.1371/journal.pone.0064989

Figure Lengend Snippet: (A) VEGF-A protein levels in the amniotic fluid. Independent samples T-test revealed no significant difference in VEGF-A levels between the Tie2-Grn positive fetuses and the Tie2-Grn negative fetuses ( p = 0.423). Age of fetuses are E15.5–16.5. N = 8, GrnHi line. Error bars denote +/− S.E. VEGFR2 endothelial expression in (B) Tie2-Grn negative fetus and (C) Tie2-Grn positive fetus. Arrows show endothelial cells within the mesenteric vessels. (D) Serial sections of the Tie2-Grn vessel in (B) expressed progranulin. Scale bars denote 20 µm. Images were obtained from the GrnHi line.

Article Snippet: The anti-mouse progranulin antibody (dilution 1∶70) was purchased from R&D systems, the anti-laminin antibody (dilution 1∶50) was purchased from Abcam, the anti-smooth muscle α-actin antibody (dilution 1∶100) and the anti-desmin (dilution 1∶100) were purchased from Dako; the anti-PECAM1 antibody (dilution 1∶25) was purchased from Santa Cruz and the VEGFR2 antibody (dilution 1∶600) was purchased from Cell Signaling.

Techniques: Expressing

The upper bar summarizes major landmarks in vascular development. VEGF and its receptors (yellow bar) are required for early vasculogenesis and for angiogenesis throughout development. Tie2 and its ligand angiopoietin (red bar) are required for cardiac development and for vessel stabilization, but not for early vasculogenesis (see text for details). When progranulin was expressed developmentally (purple bar) it had no effect on vasculogenesis, the formation of the primary capillary plexus, sprouting or endothelial-mesenchymal transition. Its major actions were on vessel size and structural stability in late embryonic and neonatal phases. The timing of its actions is therefore distinct from those of the well-established angiogenic growth factors, suggesting that its effect on vessel growth and stability constitutes a novel angiogenic pathway.

Journal: PLoS ONE

Article Title: Expression of the Growth Factor Progranulin in Endothelial Cells Influences Growth and Development of Blood Vessels: A Novel Mouse Model

doi: 10.1371/journal.pone.0064989

Figure Lengend Snippet: The upper bar summarizes major landmarks in vascular development. VEGF and its receptors (yellow bar) are required for early vasculogenesis and for angiogenesis throughout development. Tie2 and its ligand angiopoietin (red bar) are required for cardiac development and for vessel stabilization, but not for early vasculogenesis (see text for details). When progranulin was expressed developmentally (purple bar) it had no effect on vasculogenesis, the formation of the primary capillary plexus, sprouting or endothelial-mesenchymal transition. Its major actions were on vessel size and structural stability in late embryonic and neonatal phases. The timing of its actions is therefore distinct from those of the well-established angiogenic growth factors, suggesting that its effect on vessel growth and stability constitutes a novel angiogenic pathway.

Article Snippet: The anti-mouse progranulin antibody (dilution 1∶70) was purchased from R&D systems, the anti-laminin antibody (dilution 1∶50) was purchased from Abcam, the anti-smooth muscle α-actin antibody (dilution 1∶100) and the anti-desmin (dilution 1∶100) were purchased from Dako; the anti-PECAM1 antibody (dilution 1∶25) was purchased from Santa Cruz and the VEGFR2 antibody (dilution 1∶600) was purchased from Cell Signaling.

Techniques:

Expression of EGFRvIII as a fraction of total EGFR is quantified by Nanostring assay and qRT-PCR in 189 GBMs. a Expression of EGFRvIII (exon 1–8 junctional probe) is shown as a function of EGFR kinase domain ( KD ), determined by normalized Nanostring ( NS ) counts. Expression levels are classified as high [ red mutation in >10 % transcribed allelic fraction ( TAF )], intermediate ( orange 1–10 % TAF), marginal ( black <1 % TAF) or negative ( open circles ). These color assignments are carried through panels b – d . b Correlation of EGFRvIII expression between NS and qRT-PCR. Normalized expression levels are plotted for EGFRvIII and KD from the Taqman assay (see “ ”). Samples are colored according to NS expression classification from Fig. 1a. c Cross-platform correlation of EGFRvIII epression, NS vs. qRT-PCR. d Cross-platform correlation of EGFRvIII as a fraction of total EGFR, NS vs. qRT-PCR. e Experimental design of dilution experiment to establish linearity of the Nanostring assay. A sample with high relative expression of EGFRvIII was diluted with a sample negative for EGFRvIII expression, maintaining a constant 250 ng of total RNA in each reaction. f Counts of EGFRvIII and EGFR KD as a function of diluted fraction of EGFRvIII-containing sample

Journal: Acta Neuropathologica

Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates

doi: 10.1007/s00401-013-1217-3

Figure Lengend Snippet: Expression of EGFRvIII as a fraction of total EGFR is quantified by Nanostring assay and qRT-PCR in 189 GBMs. a Expression of EGFRvIII (exon 1–8 junctional probe) is shown as a function of EGFR kinase domain ( KD ), determined by normalized Nanostring ( NS ) counts. Expression levels are classified as high [ red mutation in >10 % transcribed allelic fraction ( TAF )], intermediate ( orange 1–10 % TAF), marginal ( black <1 % TAF) or negative ( open circles ). These color assignments are carried through panels b – d . b Correlation of EGFRvIII expression between NS and qRT-PCR. Normalized expression levels are plotted for EGFRvIII and KD from the Taqman assay (see “ ”). Samples are colored according to NS expression classification from Fig. 1a. c Cross-platform correlation of EGFRvIII epression, NS vs. qRT-PCR. d Cross-platform correlation of EGFRvIII as a fraction of total EGFR, NS vs. qRT-PCR. e Experimental design of dilution experiment to establish linearity of the Nanostring assay. A sample with high relative expression of EGFRvIII was diluted with a sample negative for EGFRvIII expression, maintaining a constant 250 ng of total RNA in each reaction. f Counts of EGFRvIII and EGFR KD as a function of diluted fraction of EGFRvIII-containing sample

Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan ABI Gene expression Assays Hs01076076_m1).

Techniques: Expressing, Quantitative RT-PCR, Mutagenesis, TaqMan Assay

Comparison with orthogonal platforms a EGFRvIII vs. total EGFR as determined by Nanostring is plotted. EGFRvIII expression was determined independently from TCGA RNA-seq analysis (RNAS). Red denotes cases with >10 % TAF by RNAS, green 1–10 % and blue <1 %. Black circles filled with gray mark cases where no RNAS reads identified EGFRvIII; empty circles mark cases for which RNA-seq data were unavailable. b EGFRvIII expression was compared with genomic loss of EGFR exons 2–7 in 157 cases for which both RNA and DNA (exome) sequencing data were available. Samples are ordered by the magnitude of exon 2–7 deletion inferred from DNA seq coverage. Expression was determined by the ratio of VIII junction RPKM to total EGFR

Journal: Acta Neuropathologica

Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates

doi: 10.1007/s00401-013-1217-3

Figure Lengend Snippet: Comparison with orthogonal platforms a EGFRvIII vs. total EGFR as determined by Nanostring is plotted. EGFRvIII expression was determined independently from TCGA RNA-seq analysis (RNAS). Red denotes cases with >10 % TAF by RNAS, green 1–10 % and blue <1 %. Black circles filled with gray mark cases where no RNAS reads identified EGFRvIII; empty circles mark cases for which RNA-seq data were unavailable. b EGFRvIII expression was compared with genomic loss of EGFR exons 2–7 in 157 cases for which both RNA and DNA (exome) sequencing data were available. Samples are ordered by the magnitude of exon 2–7 deletion inferred from DNA seq coverage. Expression was determined by the ratio of VIII junction RPKM to total EGFR

Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan ABI Gene expression Assays Hs01076076_m1).

Techniques: Comparison, Expressing, RNA Sequencing, Sequencing, DNA Sequencing

Performance of Nanostring assay applied to suboptimal material. Counts of EGFR-WT ( a ) and EGFRvIII ( b ) are correlated between patient-matched samples maintained by optimal, flash-frozen, and suboptimal, versus formalin-fixed paraffin-embedded samples ( FFPE ), preservation methods. c Concordance of NS assay as a binary classifier from FFPE and frozen material

Journal: Acta Neuropathologica

Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates

doi: 10.1007/s00401-013-1217-3

Figure Lengend Snippet: Performance of Nanostring assay applied to suboptimal material. Counts of EGFR-WT ( a ) and EGFRvIII ( b ) are correlated between patient-matched samples maintained by optimal, flash-frozen, and suboptimal, versus formalin-fixed paraffin-embedded samples ( FFPE ), preservation methods. c Concordance of NS assay as a binary classifier from FFPE and frozen material

Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan ABI Gene expression Assays Hs01076076_m1).

Techniques: Formalin-fixed Paraffin-Embedded, Preserving

Genomic and clinical correlates of EGFRvIII expression. a Significant EGFRvIII expression is exclusively found in tumors with amplification of EGFR. NS counts of EGFRvIII expression are plotted with respect to kinase domain counts. Blue circles denote samples with EGFR point mutation. Red denotes tumors with high-level amplification of the EGFR locus (aCGH log2 ratio >2). For two samples with high EGFRvIII expression, but log2 ratios below 2 ( red arrows ), aCGH demonstrates focal CNA in a pattern consistent with high-level gene amplification in a subpopulation of cells (and demonstrated by FISH for one of the two cases ). b Association between EGFR status and transcriptomal subclass. c Overall survival of patients stratified by EGFRvIII status. d Overall survival of patients stratified by EGFRvIII status excluding G-CIMP tumors, which are known to have a more favorable prognosis

Journal: Acta Neuropathologica

Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates

doi: 10.1007/s00401-013-1217-3

Figure Lengend Snippet: Genomic and clinical correlates of EGFRvIII expression. a Significant EGFRvIII expression is exclusively found in tumors with amplification of EGFR. NS counts of EGFRvIII expression are plotted with respect to kinase domain counts. Blue circles denote samples with EGFR point mutation. Red denotes tumors with high-level amplification of the EGFR locus (aCGH log2 ratio >2). For two samples with high EGFRvIII expression, but log2 ratios below 2 ( red arrows ), aCGH demonstrates focal CNA in a pattern consistent with high-level gene amplification in a subpopulation of cells (and demonstrated by FISH for one of the two cases ). b Association between EGFR status and transcriptomal subclass. c Overall survival of patients stratified by EGFRvIII status. d Overall survival of patients stratified by EGFRvIII status excluding G-CIMP tumors, which are known to have a more favorable prognosis

Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan ABI Gene expression Assays Hs01076076_m1).

Techniques: Expressing, Amplification, Mutagenesis

Molecular context of EGFR alterations in GBM. From top to bottom EGFR mRNA expression, DNA copy number, deletion mutation expression, transcriptomal and methylation subclass are reported for each sample

Journal: Acta Neuropathologica

Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates

doi: 10.1007/s00401-013-1217-3

Figure Lengend Snippet: Molecular context of EGFR alterations in GBM. From top to bottom EGFR mRNA expression, DNA copy number, deletion mutation expression, transcriptomal and methylation subclass are reported for each sample

Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan ABI Gene expression Assays Hs01076076_m1).

Techniques: Expressing, Mutagenesis, Methylation

List of monoclonal and polyclonal antibodies used in the study

Journal: Journal of Alzheimer's Disease

Article Title: Palmitate Increases β-site AβPP-Cleavage Enzyme 1 Activity and Amyloid-β Genesis by Evoking Endoplasmic Reticulum Stress and Subsequent C/EBP Homologous Protein Activation

doi: 10.3233/JAD-161130

Figure Lengend Snippet: List of monoclonal and polyclonal antibodies used in the study

Article Snippet: The quantitative Real-time RT-PCR was performed using TaqMan chemistry using “Assays-on-Demand” probes (ABI, Foster City, CA) for human BACE1 ( BACE1 gene ) (Hs01121195_m1) and mouse Bace1 ( Bace1 gene ) (Mm00478664_m1), The amplification was performed using the “StepOnePlus” PCR System (ABI, Foster City, CA).

Techniques:

BACE1 expression and subsequent Aβ genesis is induced by the sFFA, palmitate and stearate, but not by their MUFA counterparts, palmitoleate and oleate. A) Representative western blots show that exogenous palmitate and stearate treatment (100 μM for 24 h), but not palmitoleate and oleate treatment (100 μM for 24 h), significantly increases BACE1 protein levels accompanied by an increase in the amyloidogenic processing of AβPP as evidenced by an increase in sAβPPβ and CTFβ levels concomitant with a decrease in sAβPPα and CTFα levels in the whole cell homogenates from SH-SY5Y-APP Swe cells. B, C) Exogenous palmitate and stearate treatment, but not palmitoleate and oleate treatment, significantly increases BACE1 mRNA expression (B) and BACE1 activity (C) in SH-SY5Y-APP Swe cells. D) ELISA immunoassays show that exogenous palmitate and stearate treatment, but not palmitoleate and oleate treatment, significantly increases the levels of the intracellular Aβ 1 - 42 species in the whole cell lysates and secreted Aβ 1 - 42 species in the conditioned media, from SH-SY5Y-APP Swe cells. The ER stress inducer, Tunicamycin, also increased the following - BACE1 protein levels (A), BACE1 mRNA expression (B) and BACE1 activity (C), and the ensuing levels of intracellular as well as secreted Aβ 1 - 42 species (D) in SH-SY5Y-APP Swe cells. Data is expressed as Mean±S.D and includes determination made in four ( n = 4) separate cell culture experiments. *** p < 0.001 versus BSA-treated cells.

Journal: Journal of Alzheimer's Disease

Article Title: Palmitate Increases β-site AβPP-Cleavage Enzyme 1 Activity and Amyloid-β Genesis by Evoking Endoplasmic Reticulum Stress and Subsequent C/EBP Homologous Protein Activation

doi: 10.3233/JAD-161130

Figure Lengend Snippet: BACE1 expression and subsequent Aβ genesis is induced by the sFFA, palmitate and stearate, but not by their MUFA counterparts, palmitoleate and oleate. A) Representative western blots show that exogenous palmitate and stearate treatment (100 μM for 24 h), but not palmitoleate and oleate treatment (100 μM for 24 h), significantly increases BACE1 protein levels accompanied by an increase in the amyloidogenic processing of AβPP as evidenced by an increase in sAβPPβ and CTFβ levels concomitant with a decrease in sAβPPα and CTFα levels in the whole cell homogenates from SH-SY5Y-APP Swe cells. B, C) Exogenous palmitate and stearate treatment, but not palmitoleate and oleate treatment, significantly increases BACE1 mRNA expression (B) and BACE1 activity (C) in SH-SY5Y-APP Swe cells. D) ELISA immunoassays show that exogenous palmitate and stearate treatment, but not palmitoleate and oleate treatment, significantly increases the levels of the intracellular Aβ 1 - 42 species in the whole cell lysates and secreted Aβ 1 - 42 species in the conditioned media, from SH-SY5Y-APP Swe cells. The ER stress inducer, Tunicamycin, also increased the following - BACE1 protein levels (A), BACE1 mRNA expression (B) and BACE1 activity (C), and the ensuing levels of intracellular as well as secreted Aβ 1 - 42 species (D) in SH-SY5Y-APP Swe cells. Data is expressed as Mean±S.D and includes determination made in four ( n = 4) separate cell culture experiments. *** p < 0.001 versus BSA-treated cells.

Article Snippet: The quantitative Real-time RT-PCR was performed using TaqMan chemistry using “Assays-on-Demand” probes (ABI, Foster City, CA) for human BACE1 ( BACE1 gene ) (Hs01121195_m1) and mouse Bace1 ( Bace1 gene ) (Mm00478664_m1), The amplification was performed using the “StepOnePlus” PCR System (ABI, Foster City, CA).

Techniques: Expressing, Western Blot, Activity Assay, Enzyme-linked Immunosorbent Assay, Cell Culture

Palmitate induces BACE1 expression and subsequent Aβ genesis by inducing ER stress. A) Representative western blots show that pretreatment (for 2 h) of the human neuroblastoma cells with the molecular chaperone 4-PBA significantly precludes the palmitate-induced increase in BACE1 protein levels accompanied by a decrease in the amyloidogenic processing of AβPP as evidenced by a decrease in the palmitate-induced increase in sAβPPβ and CTFβ levels concomitant with an increase in the palmitate-induced decrease in sAβPPα and CTFα levels in the whole cell homogenates from SH-SY5Y-APP Swe cells. B, C) Pretreatment with 4-PBA attenuates the palmitate-induced increase in BACE1 mRNA expression (B) and BACE1 activity (C) in SH-SY5Y-APP Swe cells. D) ELISA immunoassays show that pretreatment with 4-PBA significantly attenuates the exogenous palmitate treatment-induced increase in the levels of the intracellular Aβ 1 - 42 species in the whole cell lysates and secreted Aβ 1 - 42 species in the conditioned media, from SH-SY5Y-APP Swe cells. Pretreatment (for 2 h) with the molecular chaperone 4-PBA also significantly precludes the Tunicamycin-induced increase in the following - BACE1 protein levels (A), BACE1 mRNA expression (B) and BACE1 activity (C), and intracellular as well as secreted Aβ 1 - 42 species (D), in SH-SY5Y-APP Swe cells. Data is expressed as Mean±S.D and includes determination made in four ( n = 4) separate cell culture experiments. * p < 0.05, ** p < 0.01, *** p < 0.001 versus BSA-treated cells; †† p < 0.01, ††† p < 0.001, versus palmitate-treated cells or Tunicamycin-treated cells.

Journal: Journal of Alzheimer's Disease

Article Title: Palmitate Increases β-site AβPP-Cleavage Enzyme 1 Activity and Amyloid-β Genesis by Evoking Endoplasmic Reticulum Stress and Subsequent C/EBP Homologous Protein Activation

doi: 10.3233/JAD-161130

Figure Lengend Snippet: Palmitate induces BACE1 expression and subsequent Aβ genesis by inducing ER stress. A) Representative western blots show that pretreatment (for 2 h) of the human neuroblastoma cells with the molecular chaperone 4-PBA significantly precludes the palmitate-induced increase in BACE1 protein levels accompanied by a decrease in the amyloidogenic processing of AβPP as evidenced by a decrease in the palmitate-induced increase in sAβPPβ and CTFβ levels concomitant with an increase in the palmitate-induced decrease in sAβPPα and CTFα levels in the whole cell homogenates from SH-SY5Y-APP Swe cells. B, C) Pretreatment with 4-PBA attenuates the palmitate-induced increase in BACE1 mRNA expression (B) and BACE1 activity (C) in SH-SY5Y-APP Swe cells. D) ELISA immunoassays show that pretreatment with 4-PBA significantly attenuates the exogenous palmitate treatment-induced increase in the levels of the intracellular Aβ 1 - 42 species in the whole cell lysates and secreted Aβ 1 - 42 species in the conditioned media, from SH-SY5Y-APP Swe cells. Pretreatment (for 2 h) with the molecular chaperone 4-PBA also significantly precludes the Tunicamycin-induced increase in the following - BACE1 protein levels (A), BACE1 mRNA expression (B) and BACE1 activity (C), and intracellular as well as secreted Aβ 1 - 42 species (D), in SH-SY5Y-APP Swe cells. Data is expressed as Mean±S.D and includes determination made in four ( n = 4) separate cell culture experiments. * p < 0.05, ** p < 0.01, *** p < 0.001 versus BSA-treated cells; †† p < 0.01, ††† p < 0.001, versus palmitate-treated cells or Tunicamycin-treated cells.

Article Snippet: The quantitative Real-time RT-PCR was performed using TaqMan chemistry using “Assays-on-Demand” probes (ABI, Foster City, CA) for human BACE1 ( BACE1 gene ) (Hs01121195_m1) and mouse Bace1 ( Bace1 gene ) (Mm00478664_m1), The amplification was performed using the “StepOnePlus” PCR System (ABI, Foster City, CA).

Techniques: Expressing, Western Blot, Activity Assay, Enzyme-linked Immunosorbent Assay, Cell Culture

CHOP mediates the palmitate-induced increase in BACE1 expression and subsequent Aβ genesis. A) Representative western blots show that knocking-down CHOP expression using a RNAi approach significantly attenuates the palmitate-induced increase in BACE1 protein levels accompanied by a decrease in the amyloidogenic processing of AβPP as evidenced by a decrease in the palmitate-induced increase in sAβPPβ and CTFβ levels concomitant with an increase in the palmitate-induced decrease in sAβPPα and CTFα levels in the whole cell homogenates from SH-SY5Y-APP Swe cells. B, C) Knocking-down CHOP expression attenuates the palmitate-induced increase in BACE1 mRNA expression (B) and BACE1 activity (C) in SH-SY5Y-APP Swe cells. D) ELISA immunoassays show that knocking-down CHOP expression significantly mitigates the exogenous palmitate treatment-induced increase in the levels of the intracellular Aβ 1 - 42 species in the whole cell lysates and secreted Aβ 1 - 42 species in the conditioned media, from SH-SY5Y-APP Swe cells. Data is expressed as Mean±S.D and includes determination made in four ( n = 4) separate cell culture experiments. ** p < 0.01, *** p < 0.001 versus BSA-treated GFP knock-down cells or BSA-treated scrambled siRNA transfected cells; † p < 0.05, †† p < 0.01, versus palmitate-treated GFP knock-down cells or palmitate-treated scrambled siRNA transfected cells. PA, palmitic acid.

Journal: Journal of Alzheimer's Disease

Article Title: Palmitate Increases β-site AβPP-Cleavage Enzyme 1 Activity and Amyloid-β Genesis by Evoking Endoplasmic Reticulum Stress and Subsequent C/EBP Homologous Protein Activation

doi: 10.3233/JAD-161130

Figure Lengend Snippet: CHOP mediates the palmitate-induced increase in BACE1 expression and subsequent Aβ genesis. A) Representative western blots show that knocking-down CHOP expression using a RNAi approach significantly attenuates the palmitate-induced increase in BACE1 protein levels accompanied by a decrease in the amyloidogenic processing of AβPP as evidenced by a decrease in the palmitate-induced increase in sAβPPβ and CTFβ levels concomitant with an increase in the palmitate-induced decrease in sAβPPα and CTFα levels in the whole cell homogenates from SH-SY5Y-APP Swe cells. B, C) Knocking-down CHOP expression attenuates the palmitate-induced increase in BACE1 mRNA expression (B) and BACE1 activity (C) in SH-SY5Y-APP Swe cells. D) ELISA immunoassays show that knocking-down CHOP expression significantly mitigates the exogenous palmitate treatment-induced increase in the levels of the intracellular Aβ 1 - 42 species in the whole cell lysates and secreted Aβ 1 - 42 species in the conditioned media, from SH-SY5Y-APP Swe cells. Data is expressed as Mean±S.D and includes determination made in four ( n = 4) separate cell culture experiments. ** p < 0.01, *** p < 0.001 versus BSA-treated GFP knock-down cells or BSA-treated scrambled siRNA transfected cells; † p < 0.05, †† p < 0.01, versus palmitate-treated GFP knock-down cells or palmitate-treated scrambled siRNA transfected cells. PA, palmitic acid.

Article Snippet: The quantitative Real-time RT-PCR was performed using TaqMan chemistry using “Assays-on-Demand” probes (ABI, Foster City, CA) for human BACE1 ( BACE1 gene ) (Hs01121195_m1) and mouse Bace1 ( Bace1 gene ) (Mm00478664_m1), The amplification was performed using the “StepOnePlus” PCR System (ABI, Foster City, CA).

Techniques: Expressing, Western Blot, Activity Assay, Enzyme-linked Immunosorbent Assay, Cell Culture, Knockdown, Transfection

Chop –/– mice are significantly protected from the palmitate-enriched diet-induced increase in BACE1 expression and ensuing Aβ genesis. A) Representative western blots show that nine-month-old Chop –/– mice fed a palmitate-enriched diet for three months, do not exhibit the increase in BACE1 protein levels as well as the accompanying increase in sAβPPβ and CTFβ levels concomitant with a decrease in sAβPPα and CTFα levels, to the same degree in the hippocampal region compared to the C57BL/6J wild-type mice fed a palmitate-enriched diet. B, C) Chop –/– mice fed a palmitate-enriched diet do not exhibit the increase in BACE1 mRNA expression (B) and BACE1 activity (C), to the same degree in the hippocampal region compared to the C57BL/6J wild-type mice fed a palmitate-enriched diet. D) ELISA immunoassays show that the Chop –/– mice fed a palmitate-enriched diet have significantly lower levels of total formic acid-soluble Aβ 1 - 40 and Aβ 1 - 42 species in the hippocampus, compared to the C57BL/6J wild-type mice fed a palmitate-enriched diet. Data is expressed as Mean±S.D and includes determination made in six ( n = 6) different animals from each group. * p < 0.05, *** p < 0.001 versus C57BL/6J wild-type mice fed a control chow diet; † p < 0.05, †† p < 0.01, versus C57BL/6J wild-type mice fed a palmitate-enriched diet; Δ p < 0.05 versus Chop –/– mice fed a control chow diet. PA, palmitic acid.

Journal: Journal of Alzheimer's Disease

Article Title: Palmitate Increases β-site AβPP-Cleavage Enzyme 1 Activity and Amyloid-β Genesis by Evoking Endoplasmic Reticulum Stress and Subsequent C/EBP Homologous Protein Activation

doi: 10.3233/JAD-161130

Figure Lengend Snippet: Chop –/– mice are significantly protected from the palmitate-enriched diet-induced increase in BACE1 expression and ensuing Aβ genesis. A) Representative western blots show that nine-month-old Chop –/– mice fed a palmitate-enriched diet for three months, do not exhibit the increase in BACE1 protein levels as well as the accompanying increase in sAβPPβ and CTFβ levels concomitant with a decrease in sAβPPα and CTFα levels, to the same degree in the hippocampal region compared to the C57BL/6J wild-type mice fed a palmitate-enriched diet. B, C) Chop –/– mice fed a palmitate-enriched diet do not exhibit the increase in BACE1 mRNA expression (B) and BACE1 activity (C), to the same degree in the hippocampal region compared to the C57BL/6J wild-type mice fed a palmitate-enriched diet. D) ELISA immunoassays show that the Chop –/– mice fed a palmitate-enriched diet have significantly lower levels of total formic acid-soluble Aβ 1 - 40 and Aβ 1 - 42 species in the hippocampus, compared to the C57BL/6J wild-type mice fed a palmitate-enriched diet. Data is expressed as Mean±S.D and includes determination made in six ( n = 6) different animals from each group. * p < 0.05, *** p < 0.001 versus C57BL/6J wild-type mice fed a control chow diet; † p < 0.05, †† p < 0.01, versus C57BL/6J wild-type mice fed a palmitate-enriched diet; Δ p < 0.05 versus Chop –/– mice fed a control chow diet. PA, palmitic acid.

Article Snippet: The quantitative Real-time RT-PCR was performed using TaqMan chemistry using “Assays-on-Demand” probes (ABI, Foster City, CA) for human BACE1 ( BACE1 gene ) (Hs01121195_m1) and mouse Bace1 ( Bace1 gene ) (Mm00478664_m1), The amplification was performed using the “StepOnePlus” PCR System (ABI, Foster City, CA).

Techniques: Expressing, Western Blot, Activity Assay, Enzyme-linked Immunosorbent Assay, Control

Ectopic overexpression of native CHOP, but not the transcriptionally dead leucine zipper domain deficient mutant CHOP (CHOP LZ – ), evokes an increase in BACE1 expression and subsequent Aβ genesis. A) Representative western blots show that the leucine zipper domain of CHOP that is responsible for its transcriptional activity, is necessary to induce BACE1 protein levels as well as the accompanying increase in sAβPPβ and CTFβ levels concomitant with a decrease in sAβPPα and CTFα levels in SH-SY5Y-APP Swe cells. C, D) Ectopic overexpression of native CHOP ( wt CHOP), but not the transcriptionally dead leucine zipper domain deficient mutant CHOP (CHOP LZ – ), elicits an increase in BACE1 mRNA expression (B) and BACE1 activity (C) in SH-SY5Y-APP Swe cells. D) ELISA immunoassays show that the ectopic overexpression of native CHOP ( wt CHOP), but not the transcriptionally dead leucine zipper domain deficient mutant CHOP (CHOP LZ – ), increases the levels of the intracellular Aβ 1 - 42 species in the whole cell lysates and secreted Aβ 1 - 42 species in the conditioned media, from SH-SY5Y-APP Swe cells. Data is expressed as Mean±S.D and includes determination made in three ( n = 3) separate cell culture experiments. *** p < 0.001 versus empty vector (EV)-transfected cells.

Journal: Journal of Alzheimer's Disease

Article Title: Palmitate Increases β-site AβPP-Cleavage Enzyme 1 Activity and Amyloid-β Genesis by Evoking Endoplasmic Reticulum Stress and Subsequent C/EBP Homologous Protein Activation

doi: 10.3233/JAD-161130

Figure Lengend Snippet: Ectopic overexpression of native CHOP, but not the transcriptionally dead leucine zipper domain deficient mutant CHOP (CHOP LZ – ), evokes an increase in BACE1 expression and subsequent Aβ genesis. A) Representative western blots show that the leucine zipper domain of CHOP that is responsible for its transcriptional activity, is necessary to induce BACE1 protein levels as well as the accompanying increase in sAβPPβ and CTFβ levels concomitant with a decrease in sAβPPα and CTFα levels in SH-SY5Y-APP Swe cells. C, D) Ectopic overexpression of native CHOP ( wt CHOP), but not the transcriptionally dead leucine zipper domain deficient mutant CHOP (CHOP LZ – ), elicits an increase in BACE1 mRNA expression (B) and BACE1 activity (C) in SH-SY5Y-APP Swe cells. D) ELISA immunoassays show that the ectopic overexpression of native CHOP ( wt CHOP), but not the transcriptionally dead leucine zipper domain deficient mutant CHOP (CHOP LZ – ), increases the levels of the intracellular Aβ 1 - 42 species in the whole cell lysates and secreted Aβ 1 - 42 species in the conditioned media, from SH-SY5Y-APP Swe cells. Data is expressed as Mean±S.D and includes determination made in three ( n = 3) separate cell culture experiments. *** p < 0.001 versus empty vector (EV)-transfected cells.

Article Snippet: The quantitative Real-time RT-PCR was performed using TaqMan chemistry using “Assays-on-Demand” probes (ABI, Foster City, CA) for human BACE1 ( BACE1 gene ) (Hs01121195_m1) and mouse Bace1 ( Bace1 gene ) (Mm00478664_m1), The amplification was performed using the “StepOnePlus” PCR System (ABI, Foster City, CA).

Techniques: Over Expression, Mutagenesis, Expressing, Western Blot, Activity Assay, Enzyme-linked Immunosorbent Assay, Cell Culture, Plasmid Preparation, Transfection

Expression of proHB-EGF under the control of the villin promoter. (A) Villin vector. The vector consists of the 12.4 kb villin promoter sequence and the SV40 polyA signals and intron. The Mlu I and SacII sites where the HB-EGF sequence has been inserted are shown. The two PmeI cut sites for release of the entire construct are also labeled. The asterisk represents the initiation site for transcription of the villin sequences. (B) Villin-proHB-EGF construct. Human precursor HB-EGF cDNA (625 bp) was inserted into the Mlu I and SacII sites at the 3′ end of the villin promoter. (C) PCR of potential HB-EGF TG founder mice. Eight potential founder mice derived from Vill-HB-EGF-injected oocytes were screened for genomic integration of the HB-EGF transgene by PCR of tail DNA using villin promoter and HB-EGF sequence specific primers (top panel). Mouse specific β-actin primers were used as an internal control for amplification (bottom panel). Two HB-EGF TG mice were identified (lanes 2 and 4). c, control DNA (Villin-proHB-EGF). (D) Southern blot analysis of potential HB-EGF TG founder mice. DNA was isolated from the tails of the same eight potential founder mice and subjected to Southern blot analysis using HB-EGF specific probes. The positive bands in lanes 2 and 4 correlated with the PCR results, confirming the identification of two HB-EGF TG mice. C, FVB control DNA.

Journal: Growth factors (Chur, Switzerland)

Article Title: Intestinal phenotype in mice overexpressing a heparin-binding EGF-like growth factor transgene in enterocytes

doi: 10.3109/08977190903407365

Figure Lengend Snippet: Expression of proHB-EGF under the control of the villin promoter. (A) Villin vector. The vector consists of the 12.4 kb villin promoter sequence and the SV40 polyA signals and intron. The Mlu I and SacII sites where the HB-EGF sequence has been inserted are shown. The two PmeI cut sites for release of the entire construct are also labeled. The asterisk represents the initiation site for transcription of the villin sequences. (B) Villin-proHB-EGF construct. Human precursor HB-EGF cDNA (625 bp) was inserted into the Mlu I and SacII sites at the 3′ end of the villin promoter. (C) PCR of potential HB-EGF TG founder mice. Eight potential founder mice derived from Vill-HB-EGF-injected oocytes were screened for genomic integration of the HB-EGF transgene by PCR of tail DNA using villin promoter and HB-EGF sequence specific primers (top panel). Mouse specific β-actin primers were used as an internal control for amplification (bottom panel). Two HB-EGF TG mice were identified (lanes 2 and 4). c, control DNA (Villin-proHB-EGF). (D) Southern blot analysis of potential HB-EGF TG founder mice. DNA was isolated from the tails of the same eight potential founder mice and subjected to Southern blot analysis using HB-EGF specific probes. The positive bands in lanes 2 and 4 correlated with the PCR results, confirming the identification of two HB-EGF TG mice. C, FVB control DNA.

Article Snippet: Agoatanti-human HB-EGF antibody (20 ng/ml)(R&D Systems, Minneapolis, MN, USA), a rabbit anti-cleaved caspase 3 antibody (v:v = 1:200) (Cell Signaling Technology, Danvers, MA, USA), a rabbit anti-E-cadherin antibody (v:v = 1:25) (Cell Signaling Technology, Danvers, MA, USA), a rabbit polyclonal anti-chromogranin-A (v:v = 1:500) (ABCAM, Cambridge, MA, USA), or a rat monoclonal anti-prominin-1 antibody (v:v = 1:10) (Miltenyi Biotec, Auburn, CA, USA) were applied to the tissue sections according to the manufacturer’s recommended dilutions in 10% donkey serum/PBS for 1 h at RT or overnight at 4°C.

Techniques: Expressing, Plasmid Preparation, Sequencing, Construct, Labeling, Derivative Assay, Injection, Amplification, Southern Blot, Isolation

Overexpression of HB-EGF in TG mouse intestine. (A) human HB-EGF mRNA expression as determined by RT-PCR. Tissues from nine different organs were harvested from 1-month-old TG and WT mice and RNA was isolated. RT-PCR using villin- and HB-EGF-specific primers was performed (upper panel). RT-PCR for β-actin was performed in parallel as an internal control of the amplification signal (lower panel). Lanes 12–15, (−)RT controls. (B) human HB-EGF mRNA expression determined by real time RT-PCR. HB-EGF expression in TG mice was determined using real time RT-PCR with specific primers to hHB-EGF that do not amplify murine HB-EGF. Note that the Y-axis is shown in a log scale. (C) HB-EGF protein production as determined by immunoprecipitation and Western blotting. Transgene protein product from jejunal lysates (2 mg) was immunoprecipitated with a goat anti-HB-EGF polyclonal antibody (20 μg) and subsequently detected by Western blotting. WT jejunum served as a negative control (Lane 1). Recombinant mature HB-EGF protein (19 kD) spiked into WT jejunal lysates was immunoprecipitated with goat IgG to serve as an additional negative control (Lane 8) or with goat anti-HB-EGF antibodies to serve as a positive control (Lane 9). RT-PCR demonstrating the corresponding human HB-EGF transgene expression for the lanes in Panel C. WT, wild type; low, 1–low 4, intestine from four individual low expression TG mice; high 1 and high 2, intestine from two individual high expression TG mice. (D) Immunofluorescent staining of transgene human HB-EGF protein in the jejunum using anti-human-HB-EGF antibodies. Positively stained cells were stained red (Cy3). Tissues were counterstained with DAPI (blue). White arrowheads indicate perinuclear HB-EGF staining. Upper panels, magnification 200 ×; lower panels, magnification 400 ×. (E) Immunofluorescent staining of transgene human HB-EGF protein in the colon. WT, wild type; low, low expression HB-EGF TG mice; high, high expression HB-EGF TG mice. Scale bars represent 50 μm.

Journal: Growth factors (Chur, Switzerland)

Article Title: Intestinal phenotype in mice overexpressing a heparin-binding EGF-like growth factor transgene in enterocytes

doi: 10.3109/08977190903407365

Figure Lengend Snippet: Overexpression of HB-EGF in TG mouse intestine. (A) human HB-EGF mRNA expression as determined by RT-PCR. Tissues from nine different organs were harvested from 1-month-old TG and WT mice and RNA was isolated. RT-PCR using villin- and HB-EGF-specific primers was performed (upper panel). RT-PCR for β-actin was performed in parallel as an internal control of the amplification signal (lower panel). Lanes 12–15, (−)RT controls. (B) human HB-EGF mRNA expression determined by real time RT-PCR. HB-EGF expression in TG mice was determined using real time RT-PCR with specific primers to hHB-EGF that do not amplify murine HB-EGF. Note that the Y-axis is shown in a log scale. (C) HB-EGF protein production as determined by immunoprecipitation and Western blotting. Transgene protein product from jejunal lysates (2 mg) was immunoprecipitated with a goat anti-HB-EGF polyclonal antibody (20 μg) and subsequently detected by Western blotting. WT jejunum served as a negative control (Lane 1). Recombinant mature HB-EGF protein (19 kD) spiked into WT jejunal lysates was immunoprecipitated with goat IgG to serve as an additional negative control (Lane 8) or with goat anti-HB-EGF antibodies to serve as a positive control (Lane 9). RT-PCR demonstrating the corresponding human HB-EGF transgene expression for the lanes in Panel C. WT, wild type; low, 1–low 4, intestine from four individual low expression TG mice; high 1 and high 2, intestine from two individual high expression TG mice. (D) Immunofluorescent staining of transgene human HB-EGF protein in the jejunum using anti-human-HB-EGF antibodies. Positively stained cells were stained red (Cy3). Tissues were counterstained with DAPI (blue). White arrowheads indicate perinuclear HB-EGF staining. Upper panels, magnification 200 ×; lower panels, magnification 400 ×. (E) Immunofluorescent staining of transgene human HB-EGF protein in the colon. WT, wild type; low, low expression HB-EGF TG mice; high, high expression HB-EGF TG mice. Scale bars represent 50 μm.

Article Snippet: Agoatanti-human HB-EGF antibody (20 ng/ml)(R&D Systems, Minneapolis, MN, USA), a rabbit anti-cleaved caspase 3 antibody (v:v = 1:200) (Cell Signaling Technology, Danvers, MA, USA), a rabbit anti-E-cadherin antibody (v:v = 1:25) (Cell Signaling Technology, Danvers, MA, USA), a rabbit polyclonal anti-chromogranin-A (v:v = 1:500) (ABCAM, Cambridge, MA, USA), or a rat monoclonal anti-prominin-1 antibody (v:v = 1:10) (Miltenyi Biotec, Auburn, CA, USA) were applied to the tissue sections according to the manufacturer’s recommended dilutions in 10% donkey serum/PBS for 1 h at RT or overnight at 4°C.

Techniques: Over Expression, Expressing, Reverse Transcription Polymerase Chain Reaction, Isolation, Amplification, Quantitative RT-PCR, Immunoprecipitation, Western Blot, Negative Control, Recombinant, Positive Control, Staining

Body weight determinations of HB-EGF TG and WT mice. Body weights of male and female TG mice and WT littermates were determined weekly from 4–12 weeks of life. N = 35 animals per group.

Journal: Growth factors (Chur, Switzerland)

Article Title: Intestinal phenotype in mice overexpressing a heparin-binding EGF-like growth factor transgene in enterocytes

doi: 10.3109/08977190903407365

Figure Lengend Snippet: Body weight determinations of HB-EGF TG and WT mice. Body weights of male and female TG mice and WT littermates were determined weekly from 4–12 weeks of life. N = 35 animals per group.

Article Snippet: Agoatanti-human HB-EGF antibody (20 ng/ml)(R&D Systems, Minneapolis, MN, USA), a rabbit anti-cleaved caspase 3 antibody (v:v = 1:200) (Cell Signaling Technology, Danvers, MA, USA), a rabbit anti-E-cadherin antibody (v:v = 1:25) (Cell Signaling Technology, Danvers, MA, USA), a rabbit polyclonal anti-chromogranin-A (v:v = 1:500) (ABCAM, Cambridge, MA, USA), or a rat monoclonal anti-prominin-1 antibody (v:v = 1:10) (Miltenyi Biotec, Auburn, CA, USA) were applied to the tissue sections according to the manufacturer’s recommended dilutions in 10% donkey serum/PBS for 1 h at RT or overnight at 4°C.

Techniques:

Intestinal histology and morphometric analysis of HB-EGF TG and WT mice. (A) Intestinal histology. Shown are representative H&E-stained sections of duodenum from WT, high expression TG mice, and low expression TG mice at 1 month and 5 months of age. The scale bar represents 100 μm. (B) Intestinal morphometric analysis. Villous length, villous width, crypt depth, and muscle thickness in H&E-stained sections of duodenum, jejunum, and ileum from WT, high expression TG mice, and low expression TG mice were quantified using ImageJ 1.39U software. (C) Enterocyte immunostaining. Shown are jejunal sections from WT, high expression TG, and low expression TG mice immunostained with rabbit anti-E-cadherin and secondary goat anti-rabbit IgG conjugated with Alexa 560 (red). The nulei were conterstained with DAPI (blue). The scale bar represents 50 μm. (D) Enterocyte cell density. Columnar enterocyte cell densities were quantified by counting the number of cells in the distal 200 μm from the distal tips of the villi. Each graph bar represents quantification of 15 villous tips. All values shown represent mean ± SD. Statistical significance was determined by one-way ANOVA (repeated measures). * p < 0.05; ** p < 0.01; *** p < 0.005; **** p < 0.001; WT, wild type; low, low expression HB-EGF TG mice; high, high expression HB-EGF TG mice.

Journal: Growth factors (Chur, Switzerland)

Article Title: Intestinal phenotype in mice overexpressing a heparin-binding EGF-like growth factor transgene in enterocytes

doi: 10.3109/08977190903407365

Figure Lengend Snippet: Intestinal histology and morphometric analysis of HB-EGF TG and WT mice. (A) Intestinal histology. Shown are representative H&E-stained sections of duodenum from WT, high expression TG mice, and low expression TG mice at 1 month and 5 months of age. The scale bar represents 100 μm. (B) Intestinal morphometric analysis. Villous length, villous width, crypt depth, and muscle thickness in H&E-stained sections of duodenum, jejunum, and ileum from WT, high expression TG mice, and low expression TG mice were quantified using ImageJ 1.39U software. (C) Enterocyte immunostaining. Shown are jejunal sections from WT, high expression TG, and low expression TG mice immunostained with rabbit anti-E-cadherin and secondary goat anti-rabbit IgG conjugated with Alexa 560 (red). The nulei were conterstained with DAPI (blue). The scale bar represents 50 μm. (D) Enterocyte cell density. Columnar enterocyte cell densities were quantified by counting the number of cells in the distal 200 μm from the distal tips of the villi. Each graph bar represents quantification of 15 villous tips. All values shown represent mean ± SD. Statistical significance was determined by one-way ANOVA (repeated measures). * p < 0.05; ** p < 0.01; *** p < 0.005; **** p < 0.001; WT, wild type; low, low expression HB-EGF TG mice; high, high expression HB-EGF TG mice.

Article Snippet: Agoatanti-human HB-EGF antibody (20 ng/ml)(R&D Systems, Minneapolis, MN, USA), a rabbit anti-cleaved caspase 3 antibody (v:v = 1:200) (Cell Signaling Technology, Danvers, MA, USA), a rabbit anti-E-cadherin antibody (v:v = 1:25) (Cell Signaling Technology, Danvers, MA, USA), a rabbit polyclonal anti-chromogranin-A (v:v = 1:500) (ABCAM, Cambridge, MA, USA), or a rat monoclonal anti-prominin-1 antibody (v:v = 1:10) (Miltenyi Biotec, Auburn, CA, USA) were applied to the tissue sections according to the manufacturer’s recommended dilutions in 10% donkey serum/PBS for 1 h at RT or overnight at 4°C.

Techniques: Staining, Expressing, Software, Immunostaining

Crypt cell proliferation in HB-EGF TG and WT mice. (A) BrdU immunostaining. Shown are representative jejunual sections from 1-month-old WT, high expression TG, and low expression TG mice subjected to BrdU immunostaining. Proliferating cells are stained red-brown. (B) Quantification of crypt cell proliferation. Proliferation indices were calculated as the percent (%) of BrdU positive nuclei/total crypt nuclei. Nuclei in at least 15 crypts from the duodenum, jejunum, and ileum were measured to determine proliferation indices. (C) SC IHC. SCs in jejunal crypts of 1-month-old WT mice are shown. SCs were labeled with rat anti-prominin-1 monoclonal antibody (red staining). (D) Quantification of SCs. Prominin-1 positive cells beneath cell +4 level in 15 crypts were counted. (E) Proliferative SCs in crypts (arrows). BrdU positive cells beneath cell +4 position were scored. The scale bars in A, C, and E represent 50 μm. Values shown are mean ± SD. Statistical significance was determined by one-way ANOVA (repeated measures). * p < 0.05; ** p < 0.01; **** p < 0.001; WT, wild type; low, low expression HB-EGF TG mice; high, high expression HB-EGF TG mice.

Journal: Growth factors (Chur, Switzerland)

Article Title: Intestinal phenotype in mice overexpressing a heparin-binding EGF-like growth factor transgene in enterocytes

doi: 10.3109/08977190903407365

Figure Lengend Snippet: Crypt cell proliferation in HB-EGF TG and WT mice. (A) BrdU immunostaining. Shown are representative jejunual sections from 1-month-old WT, high expression TG, and low expression TG mice subjected to BrdU immunostaining. Proliferating cells are stained red-brown. (B) Quantification of crypt cell proliferation. Proliferation indices were calculated as the percent (%) of BrdU positive nuclei/total crypt nuclei. Nuclei in at least 15 crypts from the duodenum, jejunum, and ileum were measured to determine proliferation indices. (C) SC IHC. SCs in jejunal crypts of 1-month-old WT mice are shown. SCs were labeled with rat anti-prominin-1 monoclonal antibody (red staining). (D) Quantification of SCs. Prominin-1 positive cells beneath cell +4 level in 15 crypts were counted. (E) Proliferative SCs in crypts (arrows). BrdU positive cells beneath cell +4 position were scored. The scale bars in A, C, and E represent 50 μm. Values shown are mean ± SD. Statistical significance was determined by one-way ANOVA (repeated measures). * p < 0.05; ** p < 0.01; **** p < 0.001; WT, wild type; low, low expression HB-EGF TG mice; high, high expression HB-EGF TG mice.

Article Snippet: Agoatanti-human HB-EGF antibody (20 ng/ml)(R&D Systems, Minneapolis, MN, USA), a rabbit anti-cleaved caspase 3 antibody (v:v = 1:200) (Cell Signaling Technology, Danvers, MA, USA), a rabbit anti-E-cadherin antibody (v:v = 1:25) (Cell Signaling Technology, Danvers, MA, USA), a rabbit polyclonal anti-chromogranin-A (v:v = 1:500) (ABCAM, Cambridge, MA, USA), or a rat monoclonal anti-prominin-1 antibody (v:v = 1:10) (Miltenyi Biotec, Auburn, CA, USA) were applied to the tissue sections according to the manufacturer’s recommended dilutions in 10% donkey serum/PBS for 1 h at RT or overnight at 4°C.

Techniques: Immunostaining, Expressing, Staining, Labeling

IEC apoptosis in HB-EGF TG and WT mice. (A) Apoptosis in ileal villi in high expression TG and WT mice at 1 and 5 months of age demonstrated by TUNEL staining (red) and anti-cleaved caspase 3 immunostaining (green), with DAPI nuclear counterstaining (blue). White arrows indicate examples of positively staining cells. The scale bar represents 50 μm. (B) Quantification of apoptotic activity in WT, low expression TG, and high expression TG villi at 1 and 5 months of age. Five to ten high power fields at 200 × magnification with the highest numbers of apoptotic cells by TUNEL staining were photographed at 200 × magnification using a Zeiss microscope and TUNEL positive cells/villus were counted. Values represent mean ± SD. Statistical significance was determined by one-way ANOVA (repeated measures). * p < 0.05; ** p < 0.01; *** p < 0.005; WT, wild type; low, low expression HB-EGF TG mice; high, high expression HB-EGF TG mice.

Journal: Growth factors (Chur, Switzerland)

Article Title: Intestinal phenotype in mice overexpressing a heparin-binding EGF-like growth factor transgene in enterocytes

doi: 10.3109/08977190903407365

Figure Lengend Snippet: IEC apoptosis in HB-EGF TG and WT mice. (A) Apoptosis in ileal villi in high expression TG and WT mice at 1 and 5 months of age demonstrated by TUNEL staining (red) and anti-cleaved caspase 3 immunostaining (green), with DAPI nuclear counterstaining (blue). White arrows indicate examples of positively staining cells. The scale bar represents 50 μm. (B) Quantification of apoptotic activity in WT, low expression TG, and high expression TG villi at 1 and 5 months of age. Five to ten high power fields at 200 × magnification with the highest numbers of apoptotic cells by TUNEL staining were photographed at 200 × magnification using a Zeiss microscope and TUNEL positive cells/villus were counted. Values represent mean ± SD. Statistical significance was determined by one-way ANOVA (repeated measures). * p < 0.05; ** p < 0.01; *** p < 0.005; WT, wild type; low, low expression HB-EGF TG mice; high, high expression HB-EGF TG mice.

Article Snippet: Agoatanti-human HB-EGF antibody (20 ng/ml)(R&D Systems, Minneapolis, MN, USA), a rabbit anti-cleaved caspase 3 antibody (v:v = 1:200) (Cell Signaling Technology, Danvers, MA, USA), a rabbit anti-E-cadherin antibody (v:v = 1:25) (Cell Signaling Technology, Danvers, MA, USA), a rabbit polyclonal anti-chromogranin-A (v:v = 1:500) (ABCAM, Cambridge, MA, USA), or a rat monoclonal anti-prominin-1 antibody (v:v = 1:10) (Miltenyi Biotec, Auburn, CA, USA) were applied to the tissue sections according to the manufacturer’s recommended dilutions in 10% donkey serum/PBS for 1 h at RT or overnight at 4°C.

Techniques: Expressing, TUNEL Assay, Staining, Immunostaining, Activity Assay, Microscopy

Intestinal goblet cell, neuroendocrine cell, and Paneth cell quantification in HB-EGF TG and WT mice. (A) Goblet cell quantification. Tissue sections were stained with PAS to stain the cytoplasm of goblet cells pink. Quantification of goblet cells in the duodenum, jejunum, and ileum of WT, low expression TG mice, and high expression TG mice was performed by counting the numbers of PAS-positive goblet cells/villous. (B) Neuroedocrine cell quantification. Neuroendocrine cells were immunostained with rabbit anti-chromogranin A antibody, with nuclear counterstaining with DAPI. Quantification of neuroendocrine cells in the jejunum and ileum of WT, low expression TG mice, and high expression TG mice was performed by counting the numbers of positively stained cells/villous. (C) Paneth cell quantification. Paneth cells were identified as granule-containing cells at the base of the crypts of H&E-stained sections, with quantification performed by counting the granule-containing cells/crypt in the jejunum of WT, high expression TG, and low expression TG mice. All values shown represent mean ± SD. Statistical analyses were performed by one-way ANOVA (repeated measures). * p < 0.05; *** p < 0.005; WT, wild type; low, low expression HB-EGFTG mice; high, high expression HB-EGFTG mice.

Journal: Growth factors (Chur, Switzerland)

Article Title: Intestinal phenotype in mice overexpressing a heparin-binding EGF-like growth factor transgene in enterocytes

doi: 10.3109/08977190903407365

Figure Lengend Snippet: Intestinal goblet cell, neuroendocrine cell, and Paneth cell quantification in HB-EGF TG and WT mice. (A) Goblet cell quantification. Tissue sections were stained with PAS to stain the cytoplasm of goblet cells pink. Quantification of goblet cells in the duodenum, jejunum, and ileum of WT, low expression TG mice, and high expression TG mice was performed by counting the numbers of PAS-positive goblet cells/villous. (B) Neuroedocrine cell quantification. Neuroendocrine cells were immunostained with rabbit anti-chromogranin A antibody, with nuclear counterstaining with DAPI. Quantification of neuroendocrine cells in the jejunum and ileum of WT, low expression TG mice, and high expression TG mice was performed by counting the numbers of positively stained cells/villous. (C) Paneth cell quantification. Paneth cells were identified as granule-containing cells at the base of the crypts of H&E-stained sections, with quantification performed by counting the granule-containing cells/crypt in the jejunum of WT, high expression TG, and low expression TG mice. All values shown represent mean ± SD. Statistical analyses were performed by one-way ANOVA (repeated measures). * p < 0.05; *** p < 0.005; WT, wild type; low, low expression HB-EGFTG mice; high, high expression HB-EGFTG mice.

Article Snippet: Agoatanti-human HB-EGF antibody (20 ng/ml)(R&D Systems, Minneapolis, MN, USA), a rabbit anti-cleaved caspase 3 antibody (v:v = 1:200) (Cell Signaling Technology, Danvers, MA, USA), a rabbit anti-E-cadherin antibody (v:v = 1:25) (Cell Signaling Technology, Danvers, MA, USA), a rabbit polyclonal anti-chromogranin-A (v:v = 1:500) (ABCAM, Cambridge, MA, USA), or a rat monoclonal anti-prominin-1 antibody (v:v = 1:10) (Miltenyi Biotec, Auburn, CA, USA) were applied to the tissue sections according to the manufacturer’s recommended dilutions in 10% donkey serum/PBS for 1 h at RT or overnight at 4°C.

Techniques: Staining, Expressing

Analysis of gut-associated lymphoid tissue (GALT) and dendritic cells in HB-EGF TG and WT mice. Lymphocytes in HB-EGF TG and WT mice. Lymphocytes from Peyer’s patches were fluorescently labeled using antibodies specific for CD3, CD4, CD8, and immunoglobulin. GALT was analysed by flow cytometry. The intestinal dendritic cells were visualized by anti-dendritic cell IHC and quantified by counting the numbers of positively stained cells/400 × high power field. Statistical analyses were performed by one-way ANOVA (repeated measures). Values shown are mean ± SD. WT, wild type; high, high expression HB-EGF TG mice.

Journal: Growth factors (Chur, Switzerland)

Article Title: Intestinal phenotype in mice overexpressing a heparin-binding EGF-like growth factor transgene in enterocytes

doi: 10.3109/08977190903407365

Figure Lengend Snippet: Analysis of gut-associated lymphoid tissue (GALT) and dendritic cells in HB-EGF TG and WT mice. Lymphocytes in HB-EGF TG and WT mice. Lymphocytes from Peyer’s patches were fluorescently labeled using antibodies specific for CD3, CD4, CD8, and immunoglobulin. GALT was analysed by flow cytometry. The intestinal dendritic cells were visualized by anti-dendritic cell IHC and quantified by counting the numbers of positively stained cells/400 × high power field. Statistical analyses were performed by one-way ANOVA (repeated measures). Values shown are mean ± SD. WT, wild type; high, high expression HB-EGF TG mice.

Article Snippet: Agoatanti-human HB-EGF antibody (20 ng/ml)(R&D Systems, Minneapolis, MN, USA), a rabbit anti-cleaved caspase 3 antibody (v:v = 1:200) (Cell Signaling Technology, Danvers, MA, USA), a rabbit anti-E-cadherin antibody (v:v = 1:25) (Cell Signaling Technology, Danvers, MA, USA), a rabbit polyclonal anti-chromogranin-A (v:v = 1:500) (ABCAM, Cambridge, MA, USA), or a rat monoclonal anti-prominin-1 antibody (v:v = 1:10) (Miltenyi Biotec, Auburn, CA, USA) were applied to the tissue sections according to the manufacturer’s recommended dilutions in 10% donkey serum/PBS for 1 h at RT or overnight at 4°C.

Techniques: Labeling, Flow Cytometry, Staining, Expressing

Overexpression of human HB-EGF in mice subjected to HS/R. HB-EGF TG and WT mice were subjected to hemorrhagic shock (30–35 mmHg) for 90 min, followed by resuscitation for 3 h. Intestinal permeability was determined using the everted gut sac method. *p < 0.05. Values shown are mean ± SD. WT, wild type; high, high expression HB-EGF TG mice.

Journal: Growth factors (Chur, Switzerland)

Article Title: Intestinal phenotype in mice overexpressing a heparin-binding EGF-like growth factor transgene in enterocytes

doi: 10.3109/08977190903407365

Figure Lengend Snippet: Overexpression of human HB-EGF in mice subjected to HS/R. HB-EGF TG and WT mice were subjected to hemorrhagic shock (30–35 mmHg) for 90 min, followed by resuscitation for 3 h. Intestinal permeability was determined using the everted gut sac method. *p < 0.05. Values shown are mean ± SD. WT, wild type; high, high expression HB-EGF TG mice.

Article Snippet: Agoatanti-human HB-EGF antibody (20 ng/ml)(R&D Systems, Minneapolis, MN, USA), a rabbit anti-cleaved caspase 3 antibody (v:v = 1:200) (Cell Signaling Technology, Danvers, MA, USA), a rabbit anti-E-cadherin antibody (v:v = 1:25) (Cell Signaling Technology, Danvers, MA, USA), a rabbit polyclonal anti-chromogranin-A (v:v = 1:500) (ABCAM, Cambridge, MA, USA), or a rat monoclonal anti-prominin-1 antibody (v:v = 1:10) (Miltenyi Biotec, Auburn, CA, USA) were applied to the tissue sections according to the manufacturer’s recommended dilutions in 10% donkey serum/PBS for 1 h at RT or overnight at 4°C.

Techniques: Over Expression, Permeability, Expressing